EMAIL THIS PAGE TO A FRIEND

TMEM175

transmembrane protein 175

UniProtKB ID: Q9BSA9, D3DVN4, Q8ND13
Gene ID:
Mouse(72392) transmembrane protein 175
Rat(305623) transmembrane protein 175
Zebrafish(100002086) transmembrane protein 175
Horse(100051913) transmembrane protein 175
chicken(427293) transmembrane protein 175
dog(100682837) transmembrane protein 175
domestic cat(101093771) transmembrane protein 175
naked mole-rat(101696973) transmembrane protein 175
domestic guinea pig(100731636) transmembrane protein 175
cow(513317) transmembrane protein 175
sheep(101106432) transmembrane protein 175
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032326 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042771 MISSION® esiRNA esiRNA human TMEM175 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032326 Rosetta Predictions human pricing
NM_001013991 Rosetta Predictions rat pricing
NM_028223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189019 predicted 1226
2 SASI_Hs01_00189020 predicted 234
3 SASI_Hs02_00359694 predicted 512
4 SASI_Hs01_00189022 predicted 1417
5 SASI_Hs01_00189023 predicted 412
6 SASI_Hs01_00189024 predicted 415
7 SASI_Hs01_00189027 predicted 1057
8 SASI_Hs02_00359695 predicted 1144
9 SASI_Hs02_00359696 predicted 1199
10 SASI_Hs02_00359697 predicted 901
11 SASI_Hs01_00189018 predicted 325
12 SASI_Hs01_00189021 predicted 324
13 SASI_Hs01_00189025 predicted 382
14 SASI_Hs01_00189026 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082780 predicted 573
2 SASI_Rn01_00082782 predicted 366
3 SASI_Rn01_00082784 predicted 346
4 SASI_Rn01_00082785 predicted 1057
5 SASI_Rn01_00082787 predicted 240
6 SASI_Rn01_00082788 predicted 859
7 SASI_Rn01_00082789 predicted 1101
8 SASI_Rn02_00201345 predicted 244
9 SASI_Rn02_00201346 predicted 1359
10 SASI_Rn02_00201347 predicted 416
11 SASI_Rn01_00082781 predicted 1307
12 SASI_Rn01_00082783 predicted 1011
13 SASI_Rn01_00082786 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058960 predicted 640
2 SASI_Mm01_00058961 predicted 652
3 SASI_Mm01_00058962 predicted 1072
4 SASI_Mm01_00058963 predicted 1700
5 SASI_Mm01_00058964 predicted 1009
6 SASI_Mm01_00058965 predicted 1272
7 SASI_Mm01_00058966 predicted 976
8 SASI_Mm01_00058967 predicted 313
9 SASI_Mm01_00058968 predicted 1636
10 SASI_Mm01_00058969 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028223
TMEM175 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 175
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028223.2-1301s1c1
Sequence:CCGGGCTGCATCAGACAGAAACACTCTCGAGAGTGTTTCTGTCTGATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028223.2-2203s1c1
Sequence:CCGGGATCACATTCAGGTAGTGATACTCGAGTATCACTACCTGAATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028223.2-446s1c1
Sequence:CCGGCCTGGCCTGTATGATGACTATCTCGAGATAGTCATCATACAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028223.2-970s1c1
Sequence:CCGGCCAAGGATGTGCAAGAGAAATCTCGAGATTTCTCTTGCACATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028223.2-2114s1c1
Sequence:CCGGCCCATTCCTGTACCAGTTGTTCTCGAGAACAACTGGTACAGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028223.2-1356s1c1
Sequence:CCGGGCTTTCATGTTTGCCAAGCTTCTCGAGAAGCTTGGCAAACATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028223.2-2126s1c1
Sequence:CCGGCCAGTTGTTAGACAAAGACAACTCGAGTTGTCTTTGTCTAACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028223.2-2115s1c1
Sequence:CCGGCCATTCCTGTACCAGTTGTTACTCGAGTAACAACTGGTACAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028223
TMEM175 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 175
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028223.2-1301s1c1
Sequence:CCGGGCTGCATCAGACAGAAACACTCTCGAGAGTGTTTCTGTCTGATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028223.2-2203s1c1
Sequence:CCGGGATCACATTCAGGTAGTGATACTCGAGTATCACTACCTGAATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028223.2-446s1c1
Sequence:CCGGCCTGGCCTGTATGATGACTATCTCGAGATAGTCATCATACAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028223.2-970s1c1
Sequence:CCGGCCAAGGATGTGCAAGAGAAATCTCGAGATTTCTCTTGCACATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028223.2-2114s1c1
Sequence:CCGGCCCATTCCTGTACCAGTTGTTCTCGAGAACAACTGGTACAGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028223.2-1356s1c1
Sequence:CCGGGCTTTCATGTTTGCCAAGCTTCTCGAGAAGCTTGGCAAACATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028223.2-2126s1c1
Sequence:CCGGCCAGTTGTTAGACAAAGACAACTCGAGTTGTCTTTGTCTAACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028223.2-2115s1c1
Sequence:CCGGCCATTCCTGTACCAGTTGTTACTCGAGTAACAACTGGTACAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028223
TMEM175 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 175
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028223.2-1301s1c1
Sequence:CCGGGCTGCATCAGACAGAAACACTCTCGAGAGTGTTTCTGTCTGATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028223.2-2203s1c1
Sequence:CCGGGATCACATTCAGGTAGTGATACTCGAGTATCACTACCTGAATGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028223.2-446s1c1
Sequence:CCGGCCTGGCCTGTATGATGACTATCTCGAGATAGTCATCATACAGGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028223.2-970s1c1
Sequence:CCGGCCAAGGATGTGCAAGAGAAATCTCGAGATTTCTCTTGCACATCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028223.2-2114s1c1
Sequence:CCGGCCCATTCCTGTACCAGTTGTTCTCGAGAACAACTGGTACAGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028223.2-1356s1c1
Sequence:CCGGGCTTTCATGTTTGCCAAGCTTCTCGAGAAGCTTGGCAAACATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028223.2-2126s1c1
Sequence:CCGGCCAGTTGTTAGACAAAGACAACTCGAGTTGTCTTTGTCTAACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028223.2-2115s1c1
Sequence:CCGGCCATTCCTGTACCAGTTGTTACTCGAGTAACAACTGGTACAGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032326
TMEM175 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 175
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032326.2-443s1c1
Sequence:CCGGCTGCATGATGACCATCACCTTCTCGAGAAGGTGATGGTCATCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032326.2-299s1c1
Sequence:CCGGCAGAAGTGTACAGAGGCTTCTCTCGAGAGAAGCCTCTGTACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032326.2-962s1c1
Sequence:CCGGCAAGGATGTGAAGGAGAGGTTCTCGAGAACCTCTCCTTCACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-1422s21c1
Sequence:CCGGAGGTTCAGTGTGGGCATCTTCCTCGAGGAAGATGCCCACACTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-334s21c1
Sequence:CCGGCCGTCTACCTGATGACCTTTCCTCGAGGAAAGGTCATCAGGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-829s21c1
Sequence:CCGGCAGTGGAAGTCTTCTCGTTTGCTCGAGCAAACGAGAAGACTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-374s21c1
Sequence:CCGGGGCAGCACACACAAGGTTGTTCTCGAGAACAACCTTGTGTGTGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-502s21c1
Sequence:CCGGATGTGCCTCTGGGCATCTTCTCTCGAGAGAAGATGCCCAGAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032326
TMEM175 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 175
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032326.2-443s1c1
Sequence:CCGGCTGCATGATGACCATCACCTTCTCGAGAAGGTGATGGTCATCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032326.2-299s1c1
Sequence:CCGGCAGAAGTGTACAGAGGCTTCTCTCGAGAGAAGCCTCTGTACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032326.2-962s1c1
Sequence:CCGGCAAGGATGTGAAGGAGAGGTTCTCGAGAACCTCTCCTTCACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-1422s21c1
Sequence:CCGGAGGTTCAGTGTGGGCATCTTCCTCGAGGAAGATGCCCACACTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-334s21c1
Sequence:CCGGCCGTCTACCTGATGACCTTTCCTCGAGGAAAGGTCATCAGGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-829s21c1
Sequence:CCGGCAGTGGAAGTCTTCTCGTTTGCTCGAGCAAACGAGAAGACTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-374s21c1
Sequence:CCGGGGCAGCACACACAAGGTTGTTCTCGAGAACAACCTTGTGTGTGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-502s21c1
Sequence:CCGGATGTGCCTCTGGGCATCTTCTCTCGAGAGAAGATGCCCAGAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032326
TMEM175 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 175
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032326.2-443s1c1
Sequence:CCGGCTGCATGATGACCATCACCTTCTCGAGAAGGTGATGGTCATCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032326.2-299s1c1
Sequence:CCGGCAGAAGTGTACAGAGGCTTCTCTCGAGAGAAGCCTCTGTACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032326.2-962s1c1
Sequence:CCGGCAAGGATGTGAAGGAGAGGTTCTCGAGAACCTCTCCTTCACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-1422s21c1
Sequence:CCGGAGGTTCAGTGTGGGCATCTTCCTCGAGGAAGATGCCCACACTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-334s21c1
Sequence:CCGGCCGTCTACCTGATGACCTTTCCTCGAGGAAAGGTCATCAGGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-829s21c1
Sequence:CCGGCAGTGGAAGTCTTCTCGTTTGCTCGAGCAAACGAGAAGACTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-374s21c1
Sequence:CCGGGGCAGCACACACAAGGTTGTTCTCGAGAACAACCTTGTGTGTGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032326.2-502s21c1
Sequence:CCGGATGTGCCTCTGGGCATCTTCTCTCGAGAGAAGATGCCCAGAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks