EMAIL THIS PAGE TO A FRIEND

TMEM176A

transmembrane protein 176A

Synonyms: GS188 HCA112
UniProtKB ID: Q96HP8, D3DX00, Q9NYC7
Gene ID:
Mouse(66058) transmembrane protein 176A
Rat(297077) transmembrane protein 176A
dog(475535) transmembrane protein 176A
domestic cat(101081373) transmembrane protein 176A
cow(404082) transmembrane protein 176A
sheep(101112310) transmembrane protein 176A
domestic guinea pig(100735369) transmembrane protein 176A
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018487 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018487 Rosetta Predictions human pricing
NM_001039008 Rosetta Predictions rat pricing
NM_001098271 Rosetta Predictions mouse pricing
NM_025326 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131447 predicted 781
2 SASI_Hs01_00131448 predicted 490
3 SASI_Hs01_00131449 predicted 781
4 SASI_Hs01_00131450 predicted 741
5 SASI_Hs01_00131451 predicted 471
6 SASI_Hs01_00131452 predicted 416
7 SASI_Hs01_00131453 predicted 654
8 SASI_Hs01_00131454 predicted 263
9 SASI_Hs01_00131455 predicted 524
10 SASI_Hs01_00131456 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039815 predicted 600
2 SASI_Rn01_00039816 predicted 463
3 SASI_Rn01_00039817 predicted 258
4 SASI_Rn01_00039818 predicted 587
5 SASI_Rn01_00039819 predicted 406
6 SASI_Rn02_00204732 predicted 467
7 SASI_Rn01_00039820 predicted 559
8 SASI_Rn01_00039821 predicted 233
9 SASI_Rn01_00039822 predicted 360
10 SASI_Rn01_00039823 predicted 371
11 SASI_Rn01_00039824 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301361 predicted 298
2 SASI_Mm02_00301362 predicted 646
3 SASI_Mm02_00301363 predicted 512
4 SASI_Mm02_00301364 predicted 298
5 SASI_Mm02_00301365 predicted 658
6 SASI_Mm02_00301366 predicted 523
7 SASI_Mm02_00301367 predicted 600
8 SASI_Mm02_00301368 predicted 308
9 SASI_Mm02_00301369 predicted 400
10 SASI_Mm02_00301370 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327973 predicted 343
2 SASI_Mm01_00080616 predicted 696
3 SASI_Mm02_00327974 predicted 563
4 SASI_Mm01_00080618 predicted 354
5 SASI_Mm01_00080619 predicted 707
6 SASI_Mm01_00080620 predicted 583
7 SASI_Mm02_00327975 predicted 652
8 SASI_Mm01_00080621 predicted 358
9 SASI_Mm02_00327976 predicted 455
10 SASI_Mm01_00080623 predicted 761
11 SASI_Mm01_00080615 predicted 608
12 SASI_Mm01_00080617 predicted 1186
13 SASI_Mm01_00080622 predicted 1144
14 SASI_Mm01_00080624 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018487
TMEM176A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 176A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-280s21c1
Sequence:CCGGAGTGCAGTCCTAGGAGGATTTCTCGAGAAATCCTCCTAGGACTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-606s21c1
Sequence:CCGGATGTACCTCCTTCATGGACATCTCGAGATGTCCATGAAGGAGGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-711s21c1
Sequence:CCGGGCTGTACTGCTGGAGAATGTTCTCGAGAACATTCTCCAGCAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-120s21c1
Sequence:CCGGACAGCACACCCACATCGATGTCTCGAGACATCGATGTGGGTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-720s1c1
Sequence:CCGGCTGGAGAATGTTCCCAACCAACTCGAGTTGGTTGGGAACATTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018487.2-800s1c1
Sequence:CCGGGATTATTAGTGCCTGGTGCTTCTCGAGAAGCACCAGGCACTAATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-382s1c1
Sequence:CCGGGCTGCCTTCATTTACGAGAAACTCGAGTTTCTCGTAAATGAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-580s1c1
Sequence:CCGGCCAGAAGAAGTCAGAAGGCTACTCGAGTAGCCTTCTGACTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-751s1c1
Sequence:CCGGGACCAGAAGGAAATGTTGGAACTCGAGTTCCAACATTTCCTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-472s1c1
Sequence:CCGGGCCCTCAAACTTTGGAATGAACTCGAGTTCATTCCAAAGTTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018487.2-787s1c1
Sequence:CCGGCCATGCCTCTCCTGATTATTACTCGAGTAATAATCAGGAGAGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-506s1c1
Sequence:CCGGGCTACTCTTATTACAACAGTGCTCGAGCACTGTTGTAATAAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018487
TMEM176A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 176A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-280s21c1
Sequence:CCGGAGTGCAGTCCTAGGAGGATTTCTCGAGAAATCCTCCTAGGACTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-606s21c1
Sequence:CCGGATGTACCTCCTTCATGGACATCTCGAGATGTCCATGAAGGAGGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-711s21c1
Sequence:CCGGGCTGTACTGCTGGAGAATGTTCTCGAGAACATTCTCCAGCAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-120s21c1
Sequence:CCGGACAGCACACCCACATCGATGTCTCGAGACATCGATGTGGGTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-720s1c1
Sequence:CCGGCTGGAGAATGTTCCCAACCAACTCGAGTTGGTTGGGAACATTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018487.2-800s1c1
Sequence:CCGGGATTATTAGTGCCTGGTGCTTCTCGAGAAGCACCAGGCACTAATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-382s1c1
Sequence:CCGGGCTGCCTTCATTTACGAGAAACTCGAGTTTCTCGTAAATGAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-580s1c1
Sequence:CCGGCCAGAAGAAGTCAGAAGGCTACTCGAGTAGCCTTCTGACTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-751s1c1
Sequence:CCGGGACCAGAAGGAAATGTTGGAACTCGAGTTCCAACATTTCCTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-472s1c1
Sequence:CCGGGCCCTCAAACTTTGGAATGAACTCGAGTTCATTCCAAAGTTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018487.2-787s1c1
Sequence:CCGGCCATGCCTCTCCTGATTATTACTCGAGTAATAATCAGGAGAGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-506s1c1
Sequence:CCGGGCTACTCTTATTACAACAGTGCTCGAGCACTGTTGTAATAAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018487
TMEM176A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 176A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-280s21c1
Sequence:CCGGAGTGCAGTCCTAGGAGGATTTCTCGAGAAATCCTCCTAGGACTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-606s21c1
Sequence:CCGGATGTACCTCCTTCATGGACATCTCGAGATGTCCATGAAGGAGGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-711s21c1
Sequence:CCGGGCTGTACTGCTGGAGAATGTTCTCGAGAACATTCTCCAGCAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018487.2-120s21c1
Sequence:CCGGACAGCACACCCACATCGATGTCTCGAGACATCGATGTGGGTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-720s1c1
Sequence:CCGGCTGGAGAATGTTCCCAACCAACTCGAGTTGGTTGGGAACATTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018487.2-800s1c1
Sequence:CCGGGATTATTAGTGCCTGGTGCTTCTCGAGAAGCACCAGGCACTAATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-382s1c1
Sequence:CCGGGCTGCCTTCATTTACGAGAAACTCGAGTTTCTCGTAAATGAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-580s1c1
Sequence:CCGGCCAGAAGAAGTCAGAAGGCTACTCGAGTAGCCTTCTGACTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-751s1c1
Sequence:CCGGGACCAGAAGGAAATGTTGGAACTCGAGTTCCAACATTTCCTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-472s1c1
Sequence:CCGGGCCCTCAAACTTTGGAATGAACTCGAGTTCATTCCAAAGTTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018487.2-787s1c1
Sequence:CCGGCCATGCCTCTCCTGATTATTACTCGAGTAATAATCAGGAGAGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018487.2-506s1c1
Sequence:CCGGGCTACTCTTATTACAACAGTGCTCGAGCACTGTTGTAATAAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025326
VALIDATED
TMEM176A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 176A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025326.4-364s1c1
Sequence:CCGGGCCATTATTTAGCCATGTATTCTCGAGAATACATGGCTAAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025326.4-653s21c1
Sequence:CCGGTAGGATTGCCTTGTGCATATACTCGAGTATATGCACAAGGCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025326.4-489s21c1
Sequence:CCGGCTTCTTGTGCTGGCAAGTTTCCTCGAGGAAACTTGCCAGCACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025326.4-516s21c1
Sequence:CCGGGCTGTGGCTGCCATCGTTATTCTCGAGAATAACGATGGCAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025326.4-353s21c1
Sequence:CCGGCCTCTACATAGGCCATTATTTCTCGAGAAATAATGGCCTATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025326.2-314s1c1
Sequence:CCGGCCCTCTACATAGGCCATTATTCTCGAGAATAATGGCCTATGTAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025326.2-727s1c1
Sequence:CCGGGTATGTGTCTACATCTGGAAACTCGAGTTTCCAGATGTAGACACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025326
VALIDATED
TMEM176A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 176A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025326.4-364s1c1
Sequence:CCGGGCCATTATTTAGCCATGTATTCTCGAGAATACATGGCTAAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025326.4-653s21c1
Sequence:CCGGTAGGATTGCCTTGTGCATATACTCGAGTATATGCACAAGGCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025326.4-489s21c1
Sequence:CCGGCTTCTTGTGCTGGCAAGTTTCCTCGAGGAAACTTGCCAGCACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025326.4-516s21c1
Sequence:CCGGGCTGTGGCTGCCATCGTTATTCTCGAGAATAACGATGGCAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025326.4-353s21c1
Sequence:CCGGCCTCTACATAGGCCATTATTTCTCGAGAAATAATGGCCTATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025326.2-314s1c1
Sequence:CCGGCCCTCTACATAGGCCATTATTCTCGAGAATAATGGCCTATGTAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025326.2-727s1c1
Sequence:CCGGGTATGTGTCTACATCTGGAAACTCGAGTTTCCAGATGTAGACACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025326
VALIDATED
TMEM176A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 176A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025326.4-364s1c1
Sequence:CCGGGCCATTATTTAGCCATGTATTCTCGAGAATACATGGCTAAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025326.4-653s21c1
Sequence:CCGGTAGGATTGCCTTGTGCATATACTCGAGTATATGCACAAGGCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025326.4-489s21c1
Sequence:CCGGCTTCTTGTGCTGGCAAGTTTCCTCGAGGAAACTTGCCAGCACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025326.4-516s21c1
Sequence:CCGGGCTGTGGCTGCCATCGTTATTCTCGAGAATAACGATGGCAGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025326.4-353s21c1
Sequence:CCGGCCTCTACATAGGCCATTATTTCTCGAGAAATAATGGCCTATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025326.2-314s1c1
Sequence:CCGGCCCTCTACATAGGCCATTATTCTCGAGAATAATGGCCTATGTAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025326.2-727s1c1
Sequence:CCGGGTATGTGTCTACATCTGGAAACTCGAGTTTCCAGATGTAGACACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks