EMAIL THIS PAGE TO A FRIEND

TMEM176B

transmembrane protein 176B

Synonyms: LR8
Gene ID:
Mouse(65963) transmembrane protein 176B
Rat(171411) transmembrane protein 176B
domestic guinea pig(100735094) transmembrane protein 176B
naked mole-rat(101713185) transmembrane protein 176B
cow(615505) transmembrane protein 176B
sheep(101102387) transmembrane protein 176B
dog(610914) transmembrane protein 176B
domestic cat(101095812) transmembrane protein 176B
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014020 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101311 Rosetta Predictions human pricing
NM_001101312 Rosetta Predictions human pricing
NM_001101313 Rosetta Predictions human pricing
NM_001101314 Rosetta Predictions human pricing
NM_014020 Rosetta Predictions human pricing
NM_134390 Rosetta Predictions rat pricing
NM_023056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322556 predicted 918
2 SASI_Hs02_00322557 predicted 924
3 SASI_Hs02_00322558 predicted 1045
4 SASI_Hs02_00322559 predicted 1032
5 SASI_Hs02_00322560 predicted 840
6 SASI_Hs02_00322561 predicted 770
7 SASI_Hs02_00322562 predicted 841
8 SASI_Hs02_00322563 predicted 841
9 SASI_Hs02_00322564 predicted 819
10 SASI_Hs02_00322565 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322566 predicted 911
2 SASI_Hs02_00322567 predicted 912
3 SASI_Hs02_00322568 predicted 1032
4 SASI_Hs02_00322569 predicted 1022
5 SASI_Hs02_00322570 predicted 829
6 SASI_Hs02_00322571 predicted 766
7 SASI_Hs02_00322572 predicted 831
8 SASI_Hs02_00322573 predicted 829
9 SASI_Hs02_00322574 predicted 816
10 SASI_Hs02_00322575 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322576 predicted 838
2 SASI_Hs02_00322577 predicted 840
3 SASI_Hs02_00322578 predicted 961
4 SASI_Hs02_00322579 predicted 947
5 SASI_Hs02_00322580 predicted 759
6 SASI_Hs02_00322581 predicted 687
7 SASI_Hs02_00322582 predicted 760
8 SASI_Hs02_00322583 predicted 753
9 SASI_Hs02_00322584 predicted 741
10 SASI_Hs02_00322585 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322586 predicted 800
2 SASI_Hs02_00322587 predicted 805
3 SASI_Hs02_00322588 predicted 920
4 SASI_Hs02_00322589 predicted 904
5 SASI_Hs02_00322590 predicted 716
6 SASI_Hs02_00322591 predicted 652
7 SASI_Hs02_00322592 predicted 721
8 SASI_Hs02_00322593 predicted 723
9 SASI_Hs02_00322594 predicted 706
10 SASI_Hs02_00322595 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344992 predicted 1047
2 SASI_Hs01_00203876 predicted 1042
3 SASI_Hs02_00344993 predicted 1167
4 SASI_Hs01_00203877 predicted 1153
5 SASI_Hs02_00344994 predicted 962
6 SASI_Hs01_00203878 predicted 897
7 SASI_Hs02_00344995 predicted 967
8 SASI_Hs02_00344996 predicted 962
9 SASI_Hs02_00344997 predicted 952
10 SASI_Hs02_00344998 predicted 949
11 SASI_Hs01_00203871 predicted 391
12 SASI_Hs01_00203872 predicted 711
13 SASI_Hs01_00203873 predicted 384
14 SASI_Hs01_00203874 predicted 378
15 SASI_Hs01_00203875 predicted 772
16 SASI_Hs01_00203879 predicted 675
17 SASI_Hs01_00203880 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114209 predicted 465
2 SASI_Rn01_00114210 predicted 799
3 SASI_Rn01_00114211 predicted 633
4 SASI_Rn01_00114213 predicted 258
5 SASI_Rn01_00114215 predicted 305
6 SASI_Rn02_00267955 predicted 256
7 SASI_Rn01_00114216 predicted 591
8 SASI_Rn02_00267956 predicted 358
9 SASI_Rn01_00114218 predicted 775
10 SASI_Rn02_00267957 predicted 551
11 SASI_Rn01_00114212 predicted 757
12 SASI_Rn01_00114214 predicted 755
13 SASI_Rn01_00114217 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058930 predicted 1155
2 SASI_Mm01_00058931 predicted 937
3 SASI_Mm01_00058932 predicted 633
4 SASI_Mm01_00058933 predicted 640
5 SASI_Mm01_00058934 predicted 1026
6 SASI_Mm01_00058935 predicted 782
7 SASI_Mm01_00058936 predicted 1031
8 SASI_Mm01_00058937 predicted 1062
9 SASI_Mm01_00058938 predicted 1052
10 SASI_Mm01_00058939 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023056
VALIDATED
TMEM176B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 176B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023056.2-1458s1c1
Sequence:CCGGCGTGTCCCTGTCCATAGTAATCTCGAGATTACTATGGACAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023056.2-1102s1c1
Sequence:CCGGCCCTACTACGTCGAGATCTTTCTCGAGAAAGATCTCGACGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023056.2-1218s1c1
Sequence:CCGGGTACCTGAACATGATGATGAACTCGAGTTCATCATCATGTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023056.2-1169s1c1
Sequence:CCGGCAGTGCGATACAGTGATGATTCTCGAGAATCATCACTGTATCGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023056.2-1310s1c1
Sequence:CCGGTGGGACTAAGTCTCCGAAGTACTCGAGTACTTCGGAGACTTAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1144s21c1
Sequence:CCGGCAGTGCGATACAGTGATGATTCTCGAGAATCATCACTGTATCGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1077s21c1
Sequence:CCGGCCCTACTACGTCGAGATCTTTCTCGAGAAAGATCTCGACGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1433s21c1
Sequence:CCGGCGTGTCCCTGTCCATAGTAATCTCGAGATTACTATGGACAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1193s21c1
Sequence:CCGGGTACCTGAACATGATGATGAACTCGAGTTCATCATCATGTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023056
VALIDATED
TMEM176B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 176B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023056.2-1458s1c1
Sequence:CCGGCGTGTCCCTGTCCATAGTAATCTCGAGATTACTATGGACAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023056.2-1102s1c1
Sequence:CCGGCCCTACTACGTCGAGATCTTTCTCGAGAAAGATCTCGACGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023056.2-1218s1c1
Sequence:CCGGGTACCTGAACATGATGATGAACTCGAGTTCATCATCATGTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023056.2-1169s1c1
Sequence:CCGGCAGTGCGATACAGTGATGATTCTCGAGAATCATCACTGTATCGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023056.2-1310s1c1
Sequence:CCGGTGGGACTAAGTCTCCGAAGTACTCGAGTACTTCGGAGACTTAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1144s21c1
Sequence:CCGGCAGTGCGATACAGTGATGATTCTCGAGAATCATCACTGTATCGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1077s21c1
Sequence:CCGGCCCTACTACGTCGAGATCTTTCTCGAGAAAGATCTCGACGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1433s21c1
Sequence:CCGGCGTGTCCCTGTCCATAGTAATCTCGAGATTACTATGGACAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1193s21c1
Sequence:CCGGGTACCTGAACATGATGATGAACTCGAGTTCATCATCATGTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023056
VALIDATED
TMEM176B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 176B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023056.2-1458s1c1
Sequence:CCGGCGTGTCCCTGTCCATAGTAATCTCGAGATTACTATGGACAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023056.2-1102s1c1
Sequence:CCGGCCCTACTACGTCGAGATCTTTCTCGAGAAAGATCTCGACGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023056.2-1218s1c1
Sequence:CCGGGTACCTGAACATGATGATGAACTCGAGTTCATCATCATGTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023056.2-1169s1c1
Sequence:CCGGCAGTGCGATACAGTGATGATTCTCGAGAATCATCACTGTATCGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023056.2-1310s1c1
Sequence:CCGGTGGGACTAAGTCTCCGAAGTACTCGAGTACTTCGGAGACTTAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1144s21c1
Sequence:CCGGCAGTGCGATACAGTGATGATTCTCGAGAATCATCACTGTATCGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1077s21c1
Sequence:CCGGCCCTACTACGTCGAGATCTTTCTCGAGAAAGATCTCGACGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1433s21c1
Sequence:CCGGCGTGTCCCTGTCCATAGTAATCTCGAGATTACTATGGACAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023056.3-1193s21c1
Sequence:CCGGGTACCTGAACATGATGATGAACTCGAGTTCATCATCATGTTCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014020
TMEM176B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 176B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-404s1c1
Sequence:CCGGCTGGAGGTTCTCTGAAGAAGTCTCGAGACTTCTTCAGAGAACCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-650s1c1
Sequence:CCGGGCAAACTTGCTGGCTATATATCTCGAGATATATAGCCAGCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-925s1c1
Sequence:CCGGGTCTGTGTCTTGAAGGTCATTCTCGAGAATGACCTTCAAGACACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-885s1c1
Sequence:CCGGGAGGAAGTTGTTCACAGCAATCTCGAGATTGCTGTGAACAACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-373s1c1
Sequence:CCGGCAGGAGTCAGCTTTGACACAACTCGAGTTGTGTCAAAGCTGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-687s1c1
Sequence:CCGGGACAGGCTTTGCTACAGCTATCTCGAGATAGCTGTAGCAAAGCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-720s1c1
Sequence:CCGGCCTCTGCGTGAATAGCTTCATCTCGAGATGAAGCTATTCACGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-727s1c1
Sequence:CCGGGTGAATAGCTTCATCTGGCAACTCGAGTTGCCAGATGAAGCTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-1005s1c1
Sequence:CCGGCCTGAATGAGGAAGGATCAGACTCGAGTCTGATCCTTCCTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014020
TMEM176B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 176B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-404s1c1
Sequence:CCGGCTGGAGGTTCTCTGAAGAAGTCTCGAGACTTCTTCAGAGAACCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-650s1c1
Sequence:CCGGGCAAACTTGCTGGCTATATATCTCGAGATATATAGCCAGCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-925s1c1
Sequence:CCGGGTCTGTGTCTTGAAGGTCATTCTCGAGAATGACCTTCAAGACACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-885s1c1
Sequence:CCGGGAGGAAGTTGTTCACAGCAATCTCGAGATTGCTGTGAACAACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-373s1c1
Sequence:CCGGCAGGAGTCAGCTTTGACACAACTCGAGTTGTGTCAAAGCTGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-687s1c1
Sequence:CCGGGACAGGCTTTGCTACAGCTATCTCGAGATAGCTGTAGCAAAGCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-720s1c1
Sequence:CCGGCCTCTGCGTGAATAGCTTCATCTCGAGATGAAGCTATTCACGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-727s1c1
Sequence:CCGGGTGAATAGCTTCATCTGGCAACTCGAGTTGCCAGATGAAGCTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-1005s1c1
Sequence:CCGGCCTGAATGAGGAAGGATCAGACTCGAGTCTGATCCTTCCTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014020
TMEM176B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 176B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-404s1c1
Sequence:CCGGCTGGAGGTTCTCTGAAGAAGTCTCGAGACTTCTTCAGAGAACCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-650s1c1
Sequence:CCGGGCAAACTTGCTGGCTATATATCTCGAGATATATAGCCAGCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-925s1c1
Sequence:CCGGGTCTGTGTCTTGAAGGTCATTCTCGAGAATGACCTTCAAGACACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-885s1c1
Sequence:CCGGGAGGAAGTTGTTCACAGCAATCTCGAGATTGCTGTGAACAACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-373s1c1
Sequence:CCGGCAGGAGTCAGCTTTGACACAACTCGAGTTGTGTCAAAGCTGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-687s1c1
Sequence:CCGGGACAGGCTTTGCTACAGCTATCTCGAGATAGCTGTAGCAAAGCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-720s1c1
Sequence:CCGGCCTCTGCGTGAATAGCTTCATCTCGAGATGAAGCTATTCACGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-727s1c1
Sequence:CCGGGTGAATAGCTTCATCTGGCAACTCGAGTTGCCAGATGAAGCTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014020.2-1005s1c1
Sequence:CCGGCCTGAATGAGGAAGGATCAGACTCGAGTCTGATCCTTCCTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks