EMAIL THIS PAGE TO A FRIEND

TMEM177

transmembrane protein 177

UniProtKB ID: Q53S58, Q9BT20
Gene ID:
Mouse(66343) transmembrane protein 177
Rat(304735) transmembrane protein 177
Zebrafish(556875) transmembrane protein 177
domestic cat(101082426) transmembrane protein 177
dog(100683348) transmembrane protein 177
chicken(424232) transmembrane protein 177
cow(505501) transmembrane protein 177
sheep(101119024) transmembrane protein 177
naked mole-rat(101702940) transmembrane protein 177
domestic guinea pig(100714262) transmembrane protein 177
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030577 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105198 Rosetta Predictions human pricing
NM_001105199 Rosetta Predictions human pricing
NM_030577 Rosetta Predictions human pricing
NM_001037776 Rosetta Predictions rat pricing
NM_175106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323934 predicted 1103
2 SASI_Hs02_00323935 predicted 1127
3 SASI_Hs02_00323936 predicted 1205
4 SASI_Hs02_00323937 predicted 1277
5 SASI_Hs02_00323938 predicted 1270
6 SASI_Hs02_00323939 predicted 801
7 SASI_Hs02_00323940 predicted 682
8 SASI_Hs02_00323941 predicted 735
9 SASI_Hs02_00323942 predicted 699
10 SASI_Hs02_00323943 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323944 predicted 707
2 SASI_Hs02_00323945 predicted 737
3 SASI_Hs02_00323946 predicted 816
4 SASI_Hs02_00323947 predicted 882
5 SASI_Hs02_00323948 predicted 885
6 SASI_Hs02_00323949 predicted 417
7 SASI_Hs02_00323950 predicted 285
8 SASI_Hs02_00323951 predicted 345
9 SASI_Hs02_00323952 predicted 307
10 SASI_Hs02_00323953 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056426 predicted 764
2 SASI_Hs01_00056429 predicted 784
3 SASI_Hs01_00056430 predicted 867
4 SASI_Hs01_00056431 predicted 938
5 SASI_Hs01_00056434 predicted 930
6 SASI_Hs01_00056425 predicted 468
7 SASI_Hs01_00056427 predicted 337
8 SASI_Hs01_00056428 predicted 400
9 SASI_Hs01_00056432 predicted 355
10 SASI_Hs01_00056433 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110444 predicted 867
2 SASI_Rn01_00110445 predicted 305
3 SASI_Rn01_00110446 predicted 1085
4 SASI_Rn02_00204571 predicted 597
5 SASI_Rn01_00110448 predicted 771
6 SASI_Rn01_00110449 predicted 1055
7 SASI_Rn01_00110450 predicted 762
8 SASI_Rn01_00110451 predicted 681
9 SASI_Rn01_00110452 predicted 789
10 SASI_Rn01_00110453 predicted 1072
11 SASI_Rn01_00110447 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129662 predicted 851
2 SASI_Mm01_00129664 predicted 786
3 SASI_Mm01_00129665 predicted 857
4 SASI_Mm01_00129666 predicted 1134
5 SASI_Mm01_00129669 predicted 599
6 SASI_Mm01_00129670 predicted 611
7 SASI_Mm02_00345707 predicted 616
8 SASI_Mm01_00129671 predicted 1094
9 SASI_Mm02_00345708 predicted 710
10 SASI_Mm02_00345709 predicted 596
11 SASI_Mm01_00129663 predicted 1055
12 SASI_Mm01_00129667 predicted 1229
13 SASI_Mm01_00129668 predicted 905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030577
VALIDATED
TMEM177 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 177
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030577.2-863s21c1
Sequence:CCGGGTGGTGGAGTGGAGTTCTATGCTCGAGCATAGAACTCCACTCCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030577.2-1256s21c1
Sequence:CCGGGCTATGAATCTGAGCCTTTGTCTCGAGACAAAGGCTCAGATTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030577.2-257s21c1
Sequence:CCGGTCCAATGGCTCTACCAGTACTCTCGAGAGTACTGGTAGAGCCATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030577.2-485s21c1
Sequence:CCGGCTAACCATCCCGTGGTCATACCTCGAGGTATGACCACGGGATGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030577.2-1136s21c1
Sequence:CCGGGTTGGAGCCTTTGGACCTATACTCGAGTATAGGTCCAAAGGCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1244s1c1
Sequence:CCGGGCTATGAATCTGAGCCTTTGTCTCGAGACAAAGGCTCAGATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030577.1-959s1c1
Sequence:CCGGCCAGACACTTGTTCCGAATCACTCGAGTGATTCGGAACAAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1139s1c1
Sequence:CCGGCCTATAGCTCAAGGCCAGAAACTCGAGTTTCTGGCCTTGAGCTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030577.1-201s1c1
Sequence:CCGGGTTTGGAGTTCCAGTCTCGTACTCGAGTACGAGACTGGAACTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1124s1c1
Sequence:CCGGGTTGGAGCCTTTGGACCTATACTCGAGTATAGGTCCAAAGGCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-960s1c1
Sequence:CCGGCAGACACTTGTTCCGAATCAACTCGAGTTGATTCGGAACAAGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1245s1c1
Sequence:CCGGCTATGAATCTGAGCCTTTGTTCTCGAGAACAAAGGCTCAGATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030577
VALIDATED
TMEM177 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 177
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030577.2-863s21c1
Sequence:CCGGGTGGTGGAGTGGAGTTCTATGCTCGAGCATAGAACTCCACTCCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030577.2-1256s21c1
Sequence:CCGGGCTATGAATCTGAGCCTTTGTCTCGAGACAAAGGCTCAGATTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030577.2-257s21c1
Sequence:CCGGTCCAATGGCTCTACCAGTACTCTCGAGAGTACTGGTAGAGCCATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030577.2-485s21c1
Sequence:CCGGCTAACCATCCCGTGGTCATACCTCGAGGTATGACCACGGGATGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030577.2-1136s21c1
Sequence:CCGGGTTGGAGCCTTTGGACCTATACTCGAGTATAGGTCCAAAGGCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1244s1c1
Sequence:CCGGGCTATGAATCTGAGCCTTTGTCTCGAGACAAAGGCTCAGATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030577.1-959s1c1
Sequence:CCGGCCAGACACTTGTTCCGAATCACTCGAGTGATTCGGAACAAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1139s1c1
Sequence:CCGGCCTATAGCTCAAGGCCAGAAACTCGAGTTTCTGGCCTTGAGCTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030577.1-201s1c1
Sequence:CCGGGTTTGGAGTTCCAGTCTCGTACTCGAGTACGAGACTGGAACTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1124s1c1
Sequence:CCGGGTTGGAGCCTTTGGACCTATACTCGAGTATAGGTCCAAAGGCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-960s1c1
Sequence:CCGGCAGACACTTGTTCCGAATCAACTCGAGTTGATTCGGAACAAGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1245s1c1
Sequence:CCGGCTATGAATCTGAGCCTTTGTTCTCGAGAACAAAGGCTCAGATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030577
VALIDATED
TMEM177 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 177
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030577.2-863s21c1
Sequence:CCGGGTGGTGGAGTGGAGTTCTATGCTCGAGCATAGAACTCCACTCCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030577.2-1256s21c1
Sequence:CCGGGCTATGAATCTGAGCCTTTGTCTCGAGACAAAGGCTCAGATTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030577.2-257s21c1
Sequence:CCGGTCCAATGGCTCTACCAGTACTCTCGAGAGTACTGGTAGAGCCATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030577.2-485s21c1
Sequence:CCGGCTAACCATCCCGTGGTCATACCTCGAGGTATGACCACGGGATGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030577.2-1136s21c1
Sequence:CCGGGTTGGAGCCTTTGGACCTATACTCGAGTATAGGTCCAAAGGCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1244s1c1
Sequence:CCGGGCTATGAATCTGAGCCTTTGTCTCGAGACAAAGGCTCAGATTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030577.1-959s1c1
Sequence:CCGGCCAGACACTTGTTCCGAATCACTCGAGTGATTCGGAACAAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1139s1c1
Sequence:CCGGCCTATAGCTCAAGGCCAGAAACTCGAGTTTCTGGCCTTGAGCTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030577.1-201s1c1
Sequence:CCGGGTTTGGAGTTCCAGTCTCGTACTCGAGTACGAGACTGGAACTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1124s1c1
Sequence:CCGGGTTGGAGCCTTTGGACCTATACTCGAGTATAGGTCCAAAGGCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-960s1c1
Sequence:CCGGCAGACACTTGTTCCGAATCAACTCGAGTTGATTCGGAACAAGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030577.1-1245s1c1
Sequence:CCGGCTATGAATCTGAGCCTTTGTTCTCGAGAACAAAGGCTCAGATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175106
VALIDATED
TMEM177 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 177
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175106.3-598s1c1
Sequence:CCGGGAACACTCTGTGATCATACATCTCGAGATGTATGATCACAGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-296s1c1
Sequence:CCGGGAACAAGCCTATTGGTGGGTTCTCGAGAACCCACCAATAGGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175106.2-681s1c1
Sequence:CCGGCATGTCTCATAATGCCCAGAACTCGAGTTCTGGGCATTATGAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-673s1c1
Sequence:CCGGGCCCTGACCATGTCTCATAATCTCGAGATTATGAGACATGGTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-1230s1c1
Sequence:CCGGCGTGATGAACTTGAGATGAATCTCGAGATTCATCTCAAGTTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175106.2-438s1c1
Sequence:CCGGCCTCTTCCAAGAGGTGCTAAACTCGAGTTTAGCACCTCTTGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-1294s1c1
Sequence:CCGGCCGTCTTTGGAGTTAAACAATCTCGAGATTGTTTAACTCCAAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175106
VALIDATED
TMEM177 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 177
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175106.3-598s1c1
Sequence:CCGGGAACACTCTGTGATCATACATCTCGAGATGTATGATCACAGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-296s1c1
Sequence:CCGGGAACAAGCCTATTGGTGGGTTCTCGAGAACCCACCAATAGGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175106.2-681s1c1
Sequence:CCGGCATGTCTCATAATGCCCAGAACTCGAGTTCTGGGCATTATGAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-673s1c1
Sequence:CCGGGCCCTGACCATGTCTCATAATCTCGAGATTATGAGACATGGTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-1230s1c1
Sequence:CCGGCGTGATGAACTTGAGATGAATCTCGAGATTCATCTCAAGTTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175106.2-438s1c1
Sequence:CCGGCCTCTTCCAAGAGGTGCTAAACTCGAGTTTAGCACCTCTTGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-1294s1c1
Sequence:CCGGCCGTCTTTGGAGTTAAACAATCTCGAGATTGTTTAACTCCAAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175106
VALIDATED
TMEM177 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 177
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175106.3-598s1c1
Sequence:CCGGGAACACTCTGTGATCATACATCTCGAGATGTATGATCACAGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-296s1c1
Sequence:CCGGGAACAAGCCTATTGGTGGGTTCTCGAGAACCCACCAATAGGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175106.2-681s1c1
Sequence:CCGGCATGTCTCATAATGCCCAGAACTCGAGTTCTGGGCATTATGAGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-673s1c1
Sequence:CCGGGCCCTGACCATGTCTCATAATCTCGAGATTATGAGACATGGTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-1230s1c1
Sequence:CCGGCGTGATGAACTTGAGATGAATCTCGAGATTCATCTCAAGTTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175106.2-438s1c1
Sequence:CCGGCCTCTTCCAAGAGGTGCTAAACTCGAGTTTAGCACCTCTTGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175106.2-1294s1c1
Sequence:CCGGCCGTCTTTGGAGTTAAACAATCTCGAGATTGTTTAACTCCAAAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks