EMAIL THIS PAGE TO A FRIEND

TMEM178A

transmembrane protein 178A

Synonyms: TMEM178
UniProtKB ID: Q8NBL3, Q6UWI6, Q8N6N4
Gene ID:
Rat(362691) transmembrane protein 178A
domestic cat(101098133) transmembrane protein 178A
sheep(101118096) transmembrane protein 178A
domestic guinea pig(100721719) transmembrane protein 178A
naked mole-rat(101710139) transmembrane protein 178A
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152390 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053961 MISSION® esiRNA esiRNA human TMEM178 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152390 Rosetta Predictions human pricing
NM_001004282 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217869 predicted 853
2 SASI_Hs01_00217870 predicted 1109
3 SASI_Hs01_00217871 predicted 1156
4 SASI_Hs01_00217872 predicted 709
5 SASI_Hs01_00217873 predicted 695
6 SASI_Hs01_00217874 predicted 1065
7 SASI_Hs01_00217875 predicted 693
8 SASI_Hs01_00217876 predicted 1106
9 SASI_Hs01_00217877 predicted 771
10 SASI_Hs01_00217878 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060842 predicted 1109
2 SASI_Rn01_00060843 predicted 838
3 SASI_Rn01_00060844 predicted 849
4 SASI_Rn01_00060845 predicted 978
5 SASI_Rn01_00060846 predicted 904
6 SASI_Rn01_00060848 predicted 1158
7 SASI_Rn01_00060849 predicted 1101
8 SASI_Rn01_00060850 predicted 1097
9 SASI_Rn01_00060851 predicted 894
10 SASI_Rn02_00198328 predicted 858
11 SASI_Rn01_00060847 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152390
TMEM178A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 178A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-687s1c1
Sequence:CCGGGCACCATTTCCCTCTGTACTTCTCGAGAAGTACAGAGGGAAATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-409s1c1
Sequence:CCGGCACCCTCATCCTGAAAGGTATCTCGAGATACCTTTCAGGATGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-475s1c1
Sequence:CCGGCCGCTTGCGAAACATTCCTTTCTCGAGAAAGGAATGTTTCGCAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-712s1c1
Sequence:CCGGCGCCAGTATCTCGTATGATTTCTCGAGAAATCATACGAGATACTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-715s1c1
Sequence:CCGGCAGTATCTCGTATGATTTGAACTCGAGTTCAAATCATACGAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152390.1-1280s1c1
Sequence:CCGGCGTAACAAAGCGAGTATAATTCTCGAGAATTATACTCGCTTTGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152390
TMEM178A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 178A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-687s1c1
Sequence:CCGGGCACCATTTCCCTCTGTACTTCTCGAGAAGTACAGAGGGAAATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-409s1c1
Sequence:CCGGCACCCTCATCCTGAAAGGTATCTCGAGATACCTTTCAGGATGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-475s1c1
Sequence:CCGGCCGCTTGCGAAACATTCCTTTCTCGAGAAAGGAATGTTTCGCAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-712s1c1
Sequence:CCGGCGCCAGTATCTCGTATGATTTCTCGAGAAATCATACGAGATACTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-715s1c1
Sequence:CCGGCAGTATCTCGTATGATTTGAACTCGAGTTCAAATCATACGAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152390.1-1280s1c1
Sequence:CCGGCGTAACAAAGCGAGTATAATTCTCGAGAATTATACTCGCTTTGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152390
TMEM178A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 178A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-687s1c1
Sequence:CCGGGCACCATTTCCCTCTGTACTTCTCGAGAAGTACAGAGGGAAATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-409s1c1
Sequence:CCGGCACCCTCATCCTGAAAGGTATCTCGAGATACCTTTCAGGATGAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-475s1c1
Sequence:CCGGCCGCTTGCGAAACATTCCTTTCTCGAGAAAGGAATGTTTCGCAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-712s1c1
Sequence:CCGGCGCCAGTATCTCGTATGATTTCTCGAGAAATCATACGAGATACTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152390.1-715s1c1
Sequence:CCGGCAGTATCTCGTATGATTTGAACTCGAGTTCAAATCATACGAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152390.1-1280s1c1
Sequence:CCGGCGTAACAAAGCGAGTATAATTCTCGAGAATTATACTCGCTTTGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks