EMAIL THIS PAGE TO A FRIEND

TMEM178B

transmembrane protein 178B

UniProtKB ID: H3BS89
Gene ID:
Mouse(434008) transmembrane protein 178B
Rat(679651) transmembrane protein 178B
naked mole-rat(101704461) transmembrane protein 178B
domestic guinea pig(100736239) transmembrane protein 178B
cow(523235) transmembrane protein 178B
sheep(101107956) transmembrane protein 178B
Zebrafish(436669) transmembrane protein 178B
chicken(418120) transmembrane protein 178B
dog(482765) transmembrane protein 178B
domestic cat(101082894) transmembrane protein 178B
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001053868 Rosetta Predictions rat pricing
NM_001004182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273863 predicted 399
2 SASI_Rn02_00273864 predicted 630
3 SASI_Rn02_00273865 predicted 272
4 SASI_Rn02_00273866 predicted 658
5 SASI_Rn02_00273867 predicted 537
6 SASI_Rn02_00273868 predicted 287
7 SASI_Rn02_00273869 predicted 351
8 SASI_Rn02_00273870 predicted 242
9 SASI_Rn02_00273871 predicted 397
10 SASI_Rn02_00273872 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286508 predicted 828
2 SASI_Mm01_00173432 predicted 819
3 SASI_Mm01_00173433 predicted 942
4 SASI_Mm01_00173434 predicted 907
5 SASI_Mm01_00173435 predicted 766
6 SASI_Mm01_00173436 predicted 754
7 SASI_Mm01_00173437 predicted 251
8 SASI_Mm01_00173438 predicted 491
9 SASI_Mm01_00173439 predicted 410
10 SASI_Mm02_00286509 predicted 914
11 SASI_Mm01_00173440 predicted 476
12 SASI_Mm01_00173441 predicted 472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004182
TMEM178B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 178B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004182.1-170s1c1
Sequence:CCGGCATCCTCTTTGGCTGGATCATCTCGAGATGATCCAGCCAAAGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004182.1-373s1c1
Sequence:CCGGGATGGTCCATGTTCTGTGCATCTCGAGATGCACAGAACATGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004182.1-1765s1c1
Sequence:CCGGCGCAAGATTTAGTCCACTAATCTCGAGATTAGTGGACTAAATCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004182.1-2035s1c1
Sequence:CCGGCGCTCAAGTTTGTATGATATTCTCGAGAATATCATACAAACTTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004182
TMEM178B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 178B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004182.1-170s1c1
Sequence:CCGGCATCCTCTTTGGCTGGATCATCTCGAGATGATCCAGCCAAAGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004182.1-373s1c1
Sequence:CCGGGATGGTCCATGTTCTGTGCATCTCGAGATGCACAGAACATGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004182.1-1765s1c1
Sequence:CCGGCGCAAGATTTAGTCCACTAATCTCGAGATTAGTGGACTAAATCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004182.1-2035s1c1
Sequence:CCGGCGCTCAAGTTTGTATGATATTCTCGAGAATATCATACAAACTTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004182
TMEM178B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 178B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004182.1-170s1c1
Sequence:CCGGCATCCTCTTTGGCTGGATCATCTCGAGATGATCCAGCCAAAGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004182.1-373s1c1
Sequence:CCGGGATGGTCCATGTTCTGTGCATCTCGAGATGCACAGAACATGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004182.1-1765s1c1
Sequence:CCGGCGCAAGATTTAGTCCACTAATCTCGAGATTAGTGGACTAAATCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004182.1-2035s1c1
Sequence:CCGGCGCTCAAGTTTGTATGATATTCTCGAGAATATCATACAAACTTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks