EMAIL THIS PAGE TO A FRIEND

TMEM179

transmembrane protein 179

Synonyms: C14orf90 TMEM179A
UniProtKB ID: Q6ZVK1
Gene ID:
Mouse(104885) transmembrane protein 179
Rat(314472) transmembrane protein 179
Zebrafish(445310) transmembrane protein 179
chicken(423491) transmembrane protein 179
domestic cat(101087163) transmembrane protein 179
dog(100683315) transmembrane protein 179
cow(536682) transmembrane protein 179
naked mole-rat(101705705) transmembrane protein 179
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207379 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207379 Rosetta Predictions human pricing
NM_001126280 Rosetta Predictions rat pricing
XM_234564 Rosetta Predictions rat pricing
NM_178915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188321 predicted 1100
2 SASI_Hs02_00373982 predicted 359
3 SASI_Hs01_00188322 predicted 1089
4 SASI_Hs01_00188324 predicted 506
5 SASI_Hs01_00188325 predicted 310
6 SASI_Hs01_00188326 predicted 506
7 SASI_Hs01_00188327 predicted 490
8 SASI_Hs01_00188328 predicted 408
9 SASI_Hs01_00188329 predicted 1059
10 SASI_Hs01_00188330 predicted 1099
11 SASI_Hs01_00188323 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253173 predicted 992
2 SASI_Rn02_00253174 predicted 486
3 SASI_Rn02_00253175 predicted 1018
4 SASI_Rn02_00253176 predicted 1032
5 SASI_Rn02_00253177 predicted 678
6 SASI_Rn02_00253178 predicted 671
7 SASI_Rn02_00253179 predicted 1020
8 SASI_Rn02_00253180 predicted 1038
9 SASI_Rn02_00253181 predicted 506
10 SASI_Rn02_00253182 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156736 predicted 347
2 SASI_Rn01_00156737 predicted 1800
3 SASI_Rn01_00156738 predicted 302
4 SASI_Rn01_00156739 predicted 1822
5 SASI_Rn01_00156740 predicted 412
6 SASI_Rn01_00156741 predicted 1801
7 SASI_Rn01_00156742 predicted 469
8 SASI_Rn01_00156743 predicted 1818
9 SASI_Rn01_00156744 predicted 1779
10 SASI_Rn01_00156745 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131589 predicted 502
2 SASI_Mm02_00349531 predicted 1255
3 SASI_Mm01_00131590 predicted 1019
4 SASI_Mm01_00131591 predicted 678
5 SASI_Mm01_00131595 predicted 585
6 SASI_Mm01_00131596 predicted 237
7 SASI_Mm01_00131597 predicted 512
8 SASI_Mm01_00131598 predicted 879
9 SASI_Mm02_00349532 predicted 205
10 SASI_Mm01_00131592 predicted 661
11 SASI_Mm01_00131593 predicted 214
12 SASI_Mm01_00131594 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178915
TMEM179 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 179
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178915.2-698s1c1
Sequence:CCGGCTTTCCTGAAGGTTTATCACACTCGAGTGTGATAAACCTTCAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178915.2-243s1c1
Sequence:CCGGCCTACTCTTTACCGAGGGTATCTCGAGATACCCTCGGTAAAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178915.2-2178s1c1
Sequence:CCGGCCAAGAGAGGTCTTATGGAATCTCGAGATTCCATAAGACCTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178915.2-702s1c1
Sequence:CCGGCCTGAAGGTTTATCACAACTACTCGAGTAGTTGTGATAAACCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178915.2-621s1c1
Sequence:CCGGCTTCTACCATCAGTTTGCTATCTCGAGATAGCAAACTGATGGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178915
TMEM179 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 179
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178915.2-698s1c1
Sequence:CCGGCTTTCCTGAAGGTTTATCACACTCGAGTGTGATAAACCTTCAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178915.2-243s1c1
Sequence:CCGGCCTACTCTTTACCGAGGGTATCTCGAGATACCCTCGGTAAAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178915.2-2178s1c1
Sequence:CCGGCCAAGAGAGGTCTTATGGAATCTCGAGATTCCATAAGACCTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178915.2-702s1c1
Sequence:CCGGCCTGAAGGTTTATCACAACTACTCGAGTAGTTGTGATAAACCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178915.2-621s1c1
Sequence:CCGGCTTCTACCATCAGTTTGCTATCTCGAGATAGCAAACTGATGGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178915
TMEM179 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 179
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178915.2-698s1c1
Sequence:CCGGCTTTCCTGAAGGTTTATCACACTCGAGTGTGATAAACCTTCAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178915.2-243s1c1
Sequence:CCGGCCTACTCTTTACCGAGGGTATCTCGAGATACCCTCGGTAAAGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178915.2-2178s1c1
Sequence:CCGGCCAAGAGAGGTCTTATGGAATCTCGAGATTCCATAAGACCTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178915.2-702s1c1
Sequence:CCGGCCTGAAGGTTTATCACAACTACTCGAGTAGTTGTGATAAACCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178915.2-621s1c1
Sequence:CCGGCTTCTACCATCAGTTTGCTATCTCGAGATAGCAAACTGATGGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207379
TMEM179 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 179
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207379.1-589s1c1
Sequence:CCGGCCATTTACTGCTGGACATTTGCTCGAGCAAATGTCCAGCAGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207379.1-645s1c1
Sequence:CCGGCCTGTGTGGATAAGGTAGTTACTCGAGTAACTACCTTATCCACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207379.1-1455s1c1
Sequence:CCGGCAAAGACACCTTCATGCAAATCTCGAGATTTGCATGAAGGTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207379.1-1103s1c1
Sequence:CCGGGAGGGACGCTATTTGCTGAAACTCGAGTTTCAGCAAATAGCGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207379.1-929s21c1
Sequence:CCGGGATCAGAGCTGGAGGCTTAGACTCGAGTCTAAGCCTCCAGCTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207379.1-291s21c1
Sequence:CCGGGCACGCTCTTCTTCCTATGCACTCGAGTGCATAGGAAGAAGAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207379.1-831s21c1
Sequence:CCGGAGGTGGTGCCAGAAACGAAACCTCGAGGTTTCGTTTCTGGCACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207379
TMEM179 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 179
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207379.1-589s1c1
Sequence:CCGGCCATTTACTGCTGGACATTTGCTCGAGCAAATGTCCAGCAGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207379.1-645s1c1
Sequence:CCGGCCTGTGTGGATAAGGTAGTTACTCGAGTAACTACCTTATCCACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207379.1-1455s1c1
Sequence:CCGGCAAAGACACCTTCATGCAAATCTCGAGATTTGCATGAAGGTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207379.1-1103s1c1
Sequence:CCGGGAGGGACGCTATTTGCTGAAACTCGAGTTTCAGCAAATAGCGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207379.1-929s21c1
Sequence:CCGGGATCAGAGCTGGAGGCTTAGACTCGAGTCTAAGCCTCCAGCTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207379.1-291s21c1
Sequence:CCGGGCACGCTCTTCTTCCTATGCACTCGAGTGCATAGGAAGAAGAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207379.1-831s21c1
Sequence:CCGGAGGTGGTGCCAGAAACGAAACCTCGAGGTTTCGTTTCTGGCACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207379
TMEM179 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 179
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207379.1-589s1c1
Sequence:CCGGCCATTTACTGCTGGACATTTGCTCGAGCAAATGTCCAGCAGTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207379.1-645s1c1
Sequence:CCGGCCTGTGTGGATAAGGTAGTTACTCGAGTAACTACCTTATCCACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207379.1-1455s1c1
Sequence:CCGGCAAAGACACCTTCATGCAAATCTCGAGATTTGCATGAAGGTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207379.1-1103s1c1
Sequence:CCGGGAGGGACGCTATTTGCTGAAACTCGAGTTTCAGCAAATAGCGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207379.1-929s21c1
Sequence:CCGGGATCAGAGCTGGAGGCTTAGACTCGAGTCTAAGCCTCCAGCTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207379.1-291s21c1
Sequence:CCGGGCACGCTCTTCTTCCTATGCACTCGAGTGCATAGGAAGAAGAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207379.1-831s21c1
Sequence:CCGGAGGTGGTGCCAGAAACGAAACCTCGAGGTTTCGTTTCTGGCACCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks