EMAIL THIS PAGE TO A FRIEND

TMEM179B

transmembrane protein 179B

UniProtKB ID: Q7Z7N9
Gene ID:
Mouse(67706) transmembrane protein 179B
Rat(690263) transmembrane protein 179B
domestic guinea pig(100732828) transmembrane protein 179B
cow(512135) transmembrane protein 179B
sheep(101114827) transmembrane protein 179B
Zebrafish(793616) transmembrane protein 179B
domestic cat(101088433) transmembrane protein 179B
dog(612191) transmembrane protein 179B
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199337 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199337 Rosetta Predictions human pricing
NM_001109572 Rosetta Predictions rat pricing
NM_026325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142831 predicted 483
2 SASI_Hs01_00142832 predicted 314
3 SASI_Hs01_00142833 predicted 325
4 SASI_Hs01_00142834 predicted 353
5 SASI_Hs01_00142835 predicted 521
6 SASI_Hs01_00142836 predicted 375
7 SASI_Hs01_00142837 predicted 500
8 SASI_Hs02_00372767 predicted 358
9 SASI_Hs01_00142838 predicted 337
10 SASI_Hs01_00142839 predicted 310
11 SASI_Hs01_00142840 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249711 predicted 441
2 SASI_Rn02_00249712 predicted 233
3 SASI_Rn02_00249713 predicted 345
4 SASI_Rn02_00249714 predicted 385
5 SASI_Rn02_00249715 predicted 433
6 SASI_Rn02_00249716 predicted 444
7 SASI_Rn02_00249717 predicted 193
8 SASI_Rn02_00249718 predicted 365
9 SASI_Rn02_00249719 predicted 422
10 SASI_Rn02_00249720 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115495 predicted 404
2 SASI_Mm01_00115496 predicted 378
3 SASI_Mm01_00115498 predicted 560
4 SASI_Mm01_00115499 predicted 217
5 SASI_Mm01_00115500 predicted 291
6 SASI_Mm01_00115501 predicted 401
7 SASI_Mm01_00115502 predicted 325
8 SASI_Mm01_00115503 predicted 561
9 SASI_Mm01_00115504 predicted 321
10 SASI_Mm02_00330031 predicted 462
11 SASI_Mm01_00115497 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199337
TMEM179B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 179B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-304s21c1
Sequence:CCGGGACTCCCACAGAGGTGCTATACTCGAGTATAGCACCTCTGTGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-429s21c1
Sequence:CCGGCTCCTTGAACACTACAATTAGCTCGAGCTAATTGTAGTGTTCAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-270s21c1
Sequence:CCGGTTTGCTCTTCTGGATCTACAGCTCGAGCTGTAGATCCAGAAGAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-689s21c1
Sequence:CCGGGAAGAATAAGCGGAGTGCTTCCTCGAGGAAGCACTCCGCTTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-320s1c1
Sequence:CCGGCATCTCAGCTATAGCCGTCTTCTCGAGAAGACGGCTATAGCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199337.1-727s1c1
Sequence:CCGGCCTCAAGGCCCTGTTTATGTTCTCGAGAACATAAACAGGGCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199337.1-392s1c1
Sequence:CCGGCAACTCCATCATCTCCTTGAACTCGAGTTCAAGGAGATGATGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-485s1c1
Sequence:CCGGCAACCTACACAATGCTGAAACCTCGAGGTTTCAGCATTGTGTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199337.1-501s1c1
Sequence:CCGGGAAACCTCTTCTTGGGTGAATCTCGAGATTCACCCAAGAAGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-183s1c1
Sequence:CCGGCCATCCCTGTGCTACTTTGTACTCGAGTACAAAGTAGCACAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-358s1c1
Sequence:CCGGCCTGTATCCTTCGATTTGGCACTCGAGTGCCAAATCGAAGGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199337
TMEM179B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 179B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-304s21c1
Sequence:CCGGGACTCCCACAGAGGTGCTATACTCGAGTATAGCACCTCTGTGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-429s21c1
Sequence:CCGGCTCCTTGAACACTACAATTAGCTCGAGCTAATTGTAGTGTTCAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-270s21c1
Sequence:CCGGTTTGCTCTTCTGGATCTACAGCTCGAGCTGTAGATCCAGAAGAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-689s21c1
Sequence:CCGGGAAGAATAAGCGGAGTGCTTCCTCGAGGAAGCACTCCGCTTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-320s1c1
Sequence:CCGGCATCTCAGCTATAGCCGTCTTCTCGAGAAGACGGCTATAGCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199337.1-727s1c1
Sequence:CCGGCCTCAAGGCCCTGTTTATGTTCTCGAGAACATAAACAGGGCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199337.1-392s1c1
Sequence:CCGGCAACTCCATCATCTCCTTGAACTCGAGTTCAAGGAGATGATGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-485s1c1
Sequence:CCGGCAACCTACACAATGCTGAAACCTCGAGGTTTCAGCATTGTGTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199337.1-501s1c1
Sequence:CCGGGAAACCTCTTCTTGGGTGAATCTCGAGATTCACCCAAGAAGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-183s1c1
Sequence:CCGGCCATCCCTGTGCTACTTTGTACTCGAGTACAAAGTAGCACAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-358s1c1
Sequence:CCGGCCTGTATCCTTCGATTTGGCACTCGAGTGCCAAATCGAAGGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199337
TMEM179B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 179B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-304s21c1
Sequence:CCGGGACTCCCACAGAGGTGCTATACTCGAGTATAGCACCTCTGTGGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-429s21c1
Sequence:CCGGCTCCTTGAACACTACAATTAGCTCGAGCTAATTGTAGTGTTCAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-270s21c1
Sequence:CCGGTTTGCTCTTCTGGATCTACAGCTCGAGCTGTAGATCCAGAAGAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199337.2-689s21c1
Sequence:CCGGGAAGAATAAGCGGAGTGCTTCCTCGAGGAAGCACTCCGCTTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-320s1c1
Sequence:CCGGCATCTCAGCTATAGCCGTCTTCTCGAGAAGACGGCTATAGCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199337.1-727s1c1
Sequence:CCGGCCTCAAGGCCCTGTTTATGTTCTCGAGAACATAAACAGGGCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199337.1-392s1c1
Sequence:CCGGCAACTCCATCATCTCCTTGAACTCGAGTTCAAGGAGATGATGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-485s1c1
Sequence:CCGGCAACCTACACAATGCTGAAACCTCGAGGTTTCAGCATTGTGTAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199337.1-501s1c1
Sequence:CCGGGAAACCTCTTCTTGGGTGAATCTCGAGATTCACCCAAGAAGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-183s1c1
Sequence:CCGGCCATCCCTGTGCTACTTTGTACTCGAGTACAAAGTAGCACAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199337.1-358s1c1
Sequence:CCGGCCTGTATCCTTCGATTTGGCACTCGAGTGCCAAATCGAAGGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026325
VALIDATED
TMEM179B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 179B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-338s21c1
Sequence:CCGGCAGCCATCTTCCTGATCTTAGCTCGAGCTAAGATCAGGAAGATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-137s21c1
Sequence:CCGGATGGTGTGGCTGCACTCAATGCTCGAGCATTGAGTGCAGCCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-492s21c1
Sequence:CCGGCAACCTACATACTGCTGAAACCTCGAGGTTTCAGCAGTATGTAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-299s21c1
Sequence:CCGGGTTCTATAGGGCTCCGAATTGCTCGAGCAATTCGGAGCCCTATAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-361s21c1
Sequence:CCGGTCTGCCTGTATACTTCGATTTCTCGAGAAATCGAAGTATACAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026325.1-250s1c1
Sequence:CCGGGCTTCTCTTCTTCTGGGTCTACTCGAGTAGACCCAGAAGAAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026325.1-409s1c1
Sequence:CCGGCATCTCCTTGAACCTTACAATCTCGAGATTGTAAGGTTCAAGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026325.1-563s1c1
Sequence:CCGGGCCATGCAGTGCAAGTTTAAACTCGAGTTTAAACTTGCACTGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026325.1-384s1c1
Sequence:CCGGGCACCAATTCTTTCTGCAATTCTCGAGAATTGCAGAAAGAATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026325
VALIDATED
TMEM179B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 179B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-338s21c1
Sequence:CCGGCAGCCATCTTCCTGATCTTAGCTCGAGCTAAGATCAGGAAGATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-137s21c1
Sequence:CCGGATGGTGTGGCTGCACTCAATGCTCGAGCATTGAGTGCAGCCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-492s21c1
Sequence:CCGGCAACCTACATACTGCTGAAACCTCGAGGTTTCAGCAGTATGTAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-299s21c1
Sequence:CCGGGTTCTATAGGGCTCCGAATTGCTCGAGCAATTCGGAGCCCTATAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-361s21c1
Sequence:CCGGTCTGCCTGTATACTTCGATTTCTCGAGAAATCGAAGTATACAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026325.1-250s1c1
Sequence:CCGGGCTTCTCTTCTTCTGGGTCTACTCGAGTAGACCCAGAAGAAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026325.1-409s1c1
Sequence:CCGGCATCTCCTTGAACCTTACAATCTCGAGATTGTAAGGTTCAAGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026325.1-563s1c1
Sequence:CCGGGCCATGCAGTGCAAGTTTAAACTCGAGTTTAAACTTGCACTGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026325.1-384s1c1
Sequence:CCGGGCACCAATTCTTTCTGCAATTCTCGAGAATTGCAGAAAGAATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026325
VALIDATED
TMEM179B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 179B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-338s21c1
Sequence:CCGGCAGCCATCTTCCTGATCTTAGCTCGAGCTAAGATCAGGAAGATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-137s21c1
Sequence:CCGGATGGTGTGGCTGCACTCAATGCTCGAGCATTGAGTGCAGCCACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-492s21c1
Sequence:CCGGCAACCTACATACTGCTGAAACCTCGAGGTTTCAGCAGTATGTAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-299s21c1
Sequence:CCGGGTTCTATAGGGCTCCGAATTGCTCGAGCAATTCGGAGCCCTATAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026325.2-361s21c1
Sequence:CCGGTCTGCCTGTATACTTCGATTTCTCGAGAAATCGAAGTATACAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026325.1-250s1c1
Sequence:CCGGGCTTCTCTTCTTCTGGGTCTACTCGAGTAGACCCAGAAGAAGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026325.1-409s1c1
Sequence:CCGGCATCTCCTTGAACCTTACAATCTCGAGATTGTAAGGTTCAAGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026325.1-563s1c1
Sequence:CCGGGCCATGCAGTGCAAGTTTAAACTCGAGTTTAAACTTGCACTGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026325.1-384s1c1
Sequence:CCGGGCACCAATTCTTTCTGCAATTCTCGAGAATTGCAGAAAGAATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks