EMAIL THIS PAGE TO A FRIEND

TMEM17

transmembrane protein 17

UniProtKB ID: Q86X19, Q53QP7, Q53R98
Gene ID:
Mouse(103765) transmembrane protein 17
Rat(360985) transmembrane protein 17
cow(514758) transmembrane protein 17
sheep(101117147) transmembrane protein 17
domestic guinea pig(100713084) transmembrane protein 17
chicken(421284) transmembrane protein 17
dog(474612) transmembrane protein 17
domestic cat(101081034) transmembrane protein 17
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198276 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198276 Rosetta Predictions human pricing
NM_001010961 Rosetta Predictions rat pricing
NM_153596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085603 predicted 799
2 SASI_Hs01_00085604 predicted 630
3 SASI_Hs01_00085606 predicted 560
4 SASI_Hs02_00371828 predicted 762
5 SASI_Hs02_00371829 predicted 786
6 SASI_Hs01_00085607 predicted 560
7 SASI_Hs01_00085608 predicted 562
8 SASI_Hs01_00085609 predicted 675
9 SASI_Hs01_00085610 predicted 679
10 SASI_Hs01_00085611 predicted 593
11 SASI_Hs01_00085605 predicted 724
12 SASI_Hs01_00085612 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034442 predicted 766
2 SASI_Rn01_00034443 predicted 556
3 SASI_Rn01_00034444 predicted 993
4 SASI_Rn01_00034445 predicted 697
5 SASI_Rn01_00034447 predicted 1071
6 SASI_Rn01_00034448 predicted 475
7 SASI_Rn01_00034449 predicted 1171
8 SASI_Rn01_00034450 predicted 1112
9 SASI_Rn01_00034451 predicted 588
10 SASI_Rn02_00199832 predicted 388
11 SASI_Rn01_00034446 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343433 predicted 643
2 SASI_Mm01_00198478 predicted 837
3 SASI_Mm01_00198479 predicted 1071
4 SASI_Mm01_00198481 predicted 1017
5 SASI_Mm01_00198482 predicted 1085
6 SASI_Mm01_00198483 predicted 623
7 SASI_Mm01_00198484 predicted 434
8 SASI_Mm01_00198485 predicted 475
9 SASI_Mm01_00198486 predicted 466
10 SASI_Mm01_00198487 predicted 760
11 SASI_Mm01_00198480 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153596
TMEM17 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-466s1c1
Sequence:CCGGCTTGATTGAAGCGATCCGGTTCTCGAGAACCGGATCGCTTCAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-451s1c1
Sequence:CCGGCGTCATCCTCATAACCTTGATCTCGAGATCAAGGTTATGAGGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153596.1-955s1c1
Sequence:CCGGGCCAAGGCTCACTCATATCAACTCGAGTTGATATGAGTGAGCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-415s1c1
Sequence:CCGGCTTGCCTGACTACTACAAATTCTCGAGAATTTGTAGTAGTCAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-452s1c1
Sequence:CCGGGTCATCCTCATAACCTTGATTCTCGAGAATCAAGGTTATGAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153596
TMEM17 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-466s1c1
Sequence:CCGGCTTGATTGAAGCGATCCGGTTCTCGAGAACCGGATCGCTTCAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-451s1c1
Sequence:CCGGCGTCATCCTCATAACCTTGATCTCGAGATCAAGGTTATGAGGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153596.1-955s1c1
Sequence:CCGGGCCAAGGCTCACTCATATCAACTCGAGTTGATATGAGTGAGCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-415s1c1
Sequence:CCGGCTTGCCTGACTACTACAAATTCTCGAGAATTTGTAGTAGTCAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-452s1c1
Sequence:CCGGGTCATCCTCATAACCTTGATTCTCGAGAATCAAGGTTATGAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153596
TMEM17 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-466s1c1
Sequence:CCGGCTTGATTGAAGCGATCCGGTTCTCGAGAACCGGATCGCTTCAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-451s1c1
Sequence:CCGGCGTCATCCTCATAACCTTGATCTCGAGATCAAGGTTATGAGGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153596.1-955s1c1
Sequence:CCGGGCCAAGGCTCACTCATATCAACTCGAGTTGATATGAGTGAGCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-415s1c1
Sequence:CCGGCTTGCCTGACTACTACAAATTCTCGAGAATTTGTAGTAGTCAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153596.1-452s1c1
Sequence:CCGGGTCATCCTCATAACCTTGATTCTCGAGAATCAAGGTTATGAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198276
TMEM17 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 17
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-785s1c1
Sequence:CCGGGAGGTCATGTATAGAAGAGATCTCGAGATCTCTTCTATACATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198276.1-1195s1c1
Sequence:CCGGCCATGTTTCTTGACATGGAAACTCGAGTTTCCATGTCAAGAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-678s1c1
Sequence:CCGGGTTGCAGCATTTCTTACCTTACTCGAGTAAGGTAAGAAATGCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-428s1c1
Sequence:CCGGGCCTGACTACTACAAATTCATCTCGAGATGAATTTGTAGTAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-611s1c1
Sequence:CCGGCCTAACAAATCTGCCCTTGGACTCGAGTCCAAGGGCAGATTTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198276.2-1224s21c1
Sequence:CCGGGCCAGCTCTCTCGTAGCATTTCTCGAGAAATGCTACGAGAGAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198276.2-463s21c1
Sequence:CCGGGGCACTGCAGATGTCACTTTACTCGAGTAAAGTGACATCTGCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198276
TMEM17 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 17
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-785s1c1
Sequence:CCGGGAGGTCATGTATAGAAGAGATCTCGAGATCTCTTCTATACATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198276.1-1195s1c1
Sequence:CCGGCCATGTTTCTTGACATGGAAACTCGAGTTTCCATGTCAAGAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-678s1c1
Sequence:CCGGGTTGCAGCATTTCTTACCTTACTCGAGTAAGGTAAGAAATGCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-428s1c1
Sequence:CCGGGCCTGACTACTACAAATTCATCTCGAGATGAATTTGTAGTAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-611s1c1
Sequence:CCGGCCTAACAAATCTGCCCTTGGACTCGAGTCCAAGGGCAGATTTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198276.2-1224s21c1
Sequence:CCGGGCCAGCTCTCTCGTAGCATTTCTCGAGAAATGCTACGAGAGAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198276.2-463s21c1
Sequence:CCGGGGCACTGCAGATGTCACTTTACTCGAGTAAAGTGACATCTGCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198276
TMEM17 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 17
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-785s1c1
Sequence:CCGGGAGGTCATGTATAGAAGAGATCTCGAGATCTCTTCTATACATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198276.1-1195s1c1
Sequence:CCGGCCATGTTTCTTGACATGGAAACTCGAGTTTCCATGTCAAGAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-678s1c1
Sequence:CCGGGTTGCAGCATTTCTTACCTTACTCGAGTAAGGTAAGAAATGCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-428s1c1
Sequence:CCGGGCCTGACTACTACAAATTCATCTCGAGATGAATTTGTAGTAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198276.1-611s1c1
Sequence:CCGGCCTAACAAATCTGCCCTTGGACTCGAGTCCAAGGGCAGATTTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198276.2-1224s21c1
Sequence:CCGGGCCAGCTCTCTCGTAGCATTTCTCGAGAAATGCTACGAGAGAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198276.2-463s21c1
Sequence:CCGGGGCACTGCAGATGTCACTTTACTCGAGTAAAGTGACATCTGCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks