EMAIL THIS PAGE TO A FRIEND

TMEM180

transmembrane protein 180

Synonyms: C10orf77 bA18I14.8
UniProtKB ID: Q14CX5, Q6NWM8, Q6NWM9, Q6PEZ7, Q9H679
Gene ID:
Mouse(75146) transmembrane protein 180
naked mole-rat(101721591) transmembrane protein 180
domestic guinea pig(100724223) transmembrane protein 180
cow(514370) transmembrane protein 180
sheep(101108179) transmembrane protein 180
Zebrafish(494111) transmembrane protein 180
chicken(423861) transmembrane protein 180
dog(486862) transmembrane protein 180
domestic cat(101081576) transmembrane protein 180
Horse(100059957) transmembrane protein 180
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024789 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024789 Rosetta Predictions human pricing
NM_029186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243907 predicted 862
2 SASI_Hs01_00243908 predicted 1338
3 SASI_Hs02_00357336 predicted 1092
4 SASI_Hs01_00243909 predicted 1501
5 SASI_Hs02_00357337 predicted 748
6 SASI_Hs01_00243910 predicted 789
7 SASI_Hs01_00243911 predicted 1003
8 SASI_Hs01_00243912 predicted 1050
9 SASI_Hs01_00243915 predicted 1310
10 SASI_Hs01_00243916 predicted 1125
11 SASI_Hs01_00243913 predicted 1090
12 SASI_Hs01_00243914 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023557 predicted 1704
2 SASI_Mm01_00023558 predicted 304
3 SASI_Mm01_00023559 predicted 920
4 SASI_Mm01_00023560 predicted 809
5 SASI_Mm02_00334994 predicted 203
6 SASI_Mm02_00334995 predicted 1687
7 SASI_Mm01_00023562 predicted 1118
8 SASI_Mm01_00023563 predicted 1105
9 SASI_Mm01_00023564 predicted 822
10 SASI_Mm01_00023565 predicted 1647
11 SASI_Mm01_00023561 predicted 298
12 SASI_Mm01_00023566 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029186
VALIDATED
TMEM180 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 180
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-337s21c1
Sequence:CCGGTGGGTTGGAGAGACTGTATTTCTCGAGAAATACAGTCTCTCCAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-801s21c1
Sequence:CCGGTCTGGGAACCACACAATTATTCTCGAGAATAATTGTGTGGTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-305s21c1
Sequence:CCGGTCTCAGTGTATAAGATCAATACTCGAGTATTGATCTTATACACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029186.2-1710s1c1
Sequence:CCGGGATCCATACTCTGAACATTAACTCGAGTTAATGTTCAGAGTATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-2043s21c1
Sequence:CCGGATTTGGTGGGCTCGGGAGTTTCTCGAGAAACTCCCGAGCCCACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029186.2-1710s21c1
Sequence:CCGGGATCCATACTCTGAACATTAACTCGAGTTAATGTTCAGAGTATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029186.1-743s1c1
Sequence:CCGGGCTTTCTGGGAACCACACAATCTCGAGATTGTGTGGTTCCCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029186.1-1845s1c1
Sequence:CCGGCATGTGACTCAGCTTGTGCAACTCGAGTTGCACAAGCTGAGTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029186
VALIDATED
TMEM180 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 180
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-337s21c1
Sequence:CCGGTGGGTTGGAGAGACTGTATTTCTCGAGAAATACAGTCTCTCCAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-801s21c1
Sequence:CCGGTCTGGGAACCACACAATTATTCTCGAGAATAATTGTGTGGTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-305s21c1
Sequence:CCGGTCTCAGTGTATAAGATCAATACTCGAGTATTGATCTTATACACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029186.2-1710s1c1
Sequence:CCGGGATCCATACTCTGAACATTAACTCGAGTTAATGTTCAGAGTATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-2043s21c1
Sequence:CCGGATTTGGTGGGCTCGGGAGTTTCTCGAGAAACTCCCGAGCCCACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029186.2-1710s21c1
Sequence:CCGGGATCCATACTCTGAACATTAACTCGAGTTAATGTTCAGAGTATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029186.1-743s1c1
Sequence:CCGGGCTTTCTGGGAACCACACAATCTCGAGATTGTGTGGTTCCCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029186.1-1845s1c1
Sequence:CCGGCATGTGACTCAGCTTGTGCAACTCGAGTTGCACAAGCTGAGTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029186
VALIDATED
TMEM180 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 180
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-337s21c1
Sequence:CCGGTGGGTTGGAGAGACTGTATTTCTCGAGAAATACAGTCTCTCCAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-801s21c1
Sequence:CCGGTCTGGGAACCACACAATTATTCTCGAGAATAATTGTGTGGTTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-305s21c1
Sequence:CCGGTCTCAGTGTATAAGATCAATACTCGAGTATTGATCTTATACACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029186.2-1710s1c1
Sequence:CCGGGATCCATACTCTGAACATTAACTCGAGTTAATGTTCAGAGTATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029186.2-2043s21c1
Sequence:CCGGATTTGGTGGGCTCGGGAGTTTCTCGAGAAACTCCCGAGCCCACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029186.2-1710s21c1
Sequence:CCGGGATCCATACTCTGAACATTAACTCGAGTTAATGTTCAGAGTATGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029186.1-743s1c1
Sequence:CCGGGCTTTCTGGGAACCACACAATCTCGAGATTGTGTGGTTCCCAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029186.1-1845s1c1
Sequence:CCGGCATGTGACTCAGCTTGTGCAACTCGAGTTGCACAAGCTGAGTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024789
TMEM180 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 180
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-311s21c1
Sequence:CCGGATGTCTTCCTGCTCTACTATGCTCGAGCATAGTAGAGCAGGAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-1096s21c1
Sequence:CCGGCATCTGTTGTCCGACCATATCCTCGAGGATATGGTCGGACAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-1520s21c1
Sequence:CCGGTCTTCCAGCAGTCCCTCATAACTCGAGTTATGAGGGACTGCTGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024789.3-2142s21c1
Sequence:CCGGCCACTGTGGCCAACCTAATTTCTCGAGAAATTAGGTTGGCCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-1743s21c1
Sequence:CCGGGGCCCAAACCCTGGATGTTAACTCGAGTTAACATCCAGGGTTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024789.2-1093s1c1
Sequence:CCGGGCATCTGTTGTCCGACCATATCTCGAGATATGGTCGGACAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180709    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024789.2-2637s1c1
Sequence:CCGGGTCAGGGAAAGCTGACTGTAACTCGAGTTACAGTCAGCTTTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024789
TMEM180 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 180
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-311s21c1
Sequence:CCGGATGTCTTCCTGCTCTACTATGCTCGAGCATAGTAGAGCAGGAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-1096s21c1
Sequence:CCGGCATCTGTTGTCCGACCATATCCTCGAGGATATGGTCGGACAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-1520s21c1
Sequence:CCGGTCTTCCAGCAGTCCCTCATAACTCGAGTTATGAGGGACTGCTGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024789.3-2142s21c1
Sequence:CCGGCCACTGTGGCCAACCTAATTTCTCGAGAAATTAGGTTGGCCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-1743s21c1
Sequence:CCGGGGCCCAAACCCTGGATGTTAACTCGAGTTAACATCCAGGGTTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024789.2-1093s1c1
Sequence:CCGGGCATCTGTTGTCCGACCATATCTCGAGATATGGTCGGACAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180709    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024789.2-2637s1c1
Sequence:CCGGGTCAGGGAAAGCTGACTGTAACTCGAGTTACAGTCAGCTTTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024789
TMEM180 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 180
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-311s21c1
Sequence:CCGGATGTCTTCCTGCTCTACTATGCTCGAGCATAGTAGAGCAGGAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-1096s21c1
Sequence:CCGGCATCTGTTGTCCGACCATATCCTCGAGGATATGGTCGGACAACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-1520s21c1
Sequence:CCGGTCTTCCAGCAGTCCCTCATAACTCGAGTTATGAGGGACTGCTGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024789.3-2142s21c1
Sequence:CCGGCCACTGTGGCCAACCTAATTTCTCGAGAAATTAGGTTGGCCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024789.3-1743s21c1
Sequence:CCGGGGCCCAAACCCTGGATGTTAACTCGAGTTAACATCCAGGGTTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024789.2-1093s1c1
Sequence:CCGGGCATCTGTTGTCCGACCATATCTCGAGATATGGTCGGACAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180709    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024789.2-2637s1c1
Sequence:CCGGGTCAGGGAAAGCTGACTGTAACTCGAGTTACAGTCAGCTTTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks