EMAIL THIS PAGE TO A FRIEND

TMEM181

transmembrane protein 181

Synonyms: GPR178 KIAA1423
UniProtKB ID: Q9P2C4, Q5VTU1
Gene ID:
Human(57583) Summary: The TMEM181 gene encodes a putative G protein-coupled receptor expressed on the cell surface (Carette et al., 2009 [PubMed 19965467]
Rat(502228) transmembrane protein 181
Zebrafish(557799) transmembrane protein 181
chicken(421659) transmembrane protein 181
domestic cat(101088491) transmembrane protein 181
Horse(100059583) transmembrane protein 181
dog(612198) transmembrane protein 181
cow(614300) transmembrane protein 181
sheep(101109887) transmembrane protein 181
domestic guinea pig(100717180) transmembrane protein 181
naked mole-rat(101722342) transmembrane protein 181
Domestic Rabbit(100355801) transmembrane protein 181
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020823 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059881 MISSION® esiRNA esiRNA human TMEM181 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020823 Rosetta Predictions human pricing
XM_376550 Rosetta Predictions human pricing
NM_001130939 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354039 predicted 1367
2 SASI_Hs02_00354040 predicted 1535
3 SASI_Hs02_00354041 predicted 606
4 SASI_Hs02_00354042 predicted 1692
5 SASI_Hs02_00354043 predicted 856
6 SASI_Hs02_00354044 predicted 1605
7 SASI_Hs02_00354045 predicted 541
8 SASI_Hs02_00354046 predicted 1583
9 SASI_Hs02_00354047 predicted 1680
10 SASI_Hs02_00354048 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290138 predicted 1777
2 SASI_Hs01_00290139 predicted 1184
3 SASI_Hs01_00290140 predicted 1006
4 SASI_Hs01_00290141 predicted 2093
5 SASI_Hs01_00290142 predicted 1252
6 SASI_Hs01_00290143 predicted 2005
7 SASI_Hs01_00290144 predicted 947
8 SASI_Hs01_00290145 predicted 1989
9 SASI_Hs01_00290146 predicted 2087
10 SASI_Hs01_00290147 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256069 predicted 586
2 SASI_Rn02_00256070 predicted 1288
3 SASI_Rn02_00256071 predicted 347
4 SASI_Rn02_00256072 predicted 1419
5 SASI_Rn02_00256073 predicted 473
6 SASI_Rn02_00256074 predicted 265
7 SASI_Rn02_00256075 predicted 980
8 SASI_Rn02_00256076 predicted 219
9 SASI_Rn02_00256077 predicted 455
10 SASI_Rn02_00256078 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020823
VALIDATED
TMEM181 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 181
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020823.1-2045s21c1
Sequence:CCGGTACGAGAAGAGGCATTGATAACTCGAGTTATCAATGCCTCTTCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020823.1-1352s21c1
Sequence:CCGGTCGAGTTGATACCGGAAATTTCTCGAGAAATTTCCGGTATCAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020823.1-1005s21c1
Sequence:CCGGGCGCATTCCCTCCGGAAATTTCTCGAGAAATTTCCGGAGGGAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020823.1-801s21c1
Sequence:CCGGGGGAAATGTGCGGAGATTATTCTCGAGAATAATCTCCGCACATTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020823.1-1311s21c1
Sequence:CCGGTGGCAAACAGTTAACGAATTACTCGAGTAATTCGTTAACTGTTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020823
VALIDATED
TMEM181 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 181
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020823.1-2045s21c1
Sequence:CCGGTACGAGAAGAGGCATTGATAACTCGAGTTATCAATGCCTCTTCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020823.1-1352s21c1
Sequence:CCGGTCGAGTTGATACCGGAAATTTCTCGAGAAATTTCCGGTATCAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020823.1-1005s21c1
Sequence:CCGGGCGCATTCCCTCCGGAAATTTCTCGAGAAATTTCCGGAGGGAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020823.1-801s21c1
Sequence:CCGGGGGAAATGTGCGGAGATTATTCTCGAGAATAATCTCCGCACATTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020823.1-1311s21c1
Sequence:CCGGTGGCAAACAGTTAACGAATTACTCGAGTAATTCGTTAACTGTTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020823
VALIDATED
TMEM181 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 181
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020823.1-2045s21c1
Sequence:CCGGTACGAGAAGAGGCATTGATAACTCGAGTTATCAATGCCTCTTCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020823.1-1352s21c1
Sequence:CCGGTCGAGTTGATACCGGAAATTTCTCGAGAAATTTCCGGTATCAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020823.1-1005s21c1
Sequence:CCGGGCGCATTCCCTCCGGAAATTTCTCGAGAAATTTCCGGAGGGAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020823.1-801s21c1
Sequence:CCGGGGGAAATGTGCGGAGATTATTCTCGAGAATAATCTCCGCACATTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020823.1-1311s21c1
Sequence:CCGGTGGCAAACAGTTAACGAATTACTCGAGTAATTCGTTAACTGTTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks