EMAIL THIS PAGE TO A FRIEND

TMEM182

transmembrane protein 182

Gene ID:
Mouse(381339) transmembrane protein 182
Rat(501129) transmembrane protein 182
cow(618298) transmembrane protein 182
sheep(101102300) transmembrane protein 182
naked mole-rat(101714833) transmembrane protein 182
domestic guinea pig(100731387) transmembrane protein 182
Zebrafish(503742) transmembrane protein 182
domestic cat(101101379) transmembrane protein 182
dog(611413) transmembrane protein 182
chicken(418721) transmembrane protein 182
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045861 Anti-TMEM182 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144632 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144632 Rosetta Predictions human pricing
NM_001109305 Rosetta Predictions rat pricing
NM_001081198 Rosetta Predictions mouse pricing
XM_355302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055062 predicted 494
2 SASI_Hs01_00055065 predicted 709
3 SASI_Hs02_00364466 predicted 953
4 SASI_Hs02_00364467 predicted 712
5 SASI_Hs02_00364468 predicted 491
6 SASI_Hs01_00055067 predicted 505
7 SASI_Hs02_00364469 predicted 503
8 SASI_Hs02_00364470 predicted 558
9 SASI_Hs01_00055070 predicted 761
10 SASI_Hs02_00364471 predicted 849
11 SASI_Hs01_00055063 predicted 842
12 SASI_Hs01_00055064 predicted 913
13 SASI_Hs01_00055066 predicted 462
14 SASI_Hs01_00055068 predicted 343
15 SASI_Hs01_00055069 predicted 812
16 SASI_Hs01_00055071 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247114 predicted 462
2 SASI_Rn02_00247115 predicted 466
3 SASI_Rn02_00247116 predicted 1072
4 SASI_Rn02_00247117 predicted 598
5 SASI_Rn02_00247118 predicted 467
6 SASI_Rn02_00247119 predicted 1123
7 SASI_Rn02_00247120 predicted 1090
8 SASI_Rn02_00247121 predicted 819
9 SASI_Rn02_00247122 predicted 1130
10 SASI_Rn02_00247123 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296151 predicted 699
2 SASI_Mm02_00296152 predicted 694
3 SASI_Mm02_00296153 predicted 220
4 SASI_Mm02_00296154 predicted 534
5 SASI_Mm02_00296155 predicted 461
6 SASI_Mm02_00296156 predicted 526
7 SASI_Mm02_00296157 predicted 476
8 SASI_Mm02_00296158 predicted 737
9 SASI_Mm02_00296159 predicted 276
10 SASI_Mm02_00296160 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211807 predicted 708
2 SASI_Mm01_00211808 predicted 824
3 SASI_Mm01_00211809 predicted 822
4 SASI_Mm01_00211810 predicted 738
5 SASI_Mm01_00211811 predicted 796
6 SASI_Mm01_00211812 predicted 767
7 SASI_Mm01_00211813 predicted 704
8 SASI_Mm01_00211814 predicted 641
9 SASI_Mm01_00211815 predicted 826
10 SASI_Mm01_00211816 predicted 639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144632
VALIDATED
TMEM182 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 182
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-669s21c1
Sequence:CCGGCATTGGTGGTGATGCTGTATGCTCGAGCATACAGCATCACCACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-647s21c1
Sequence:CCGGATTGCTGCAGGCATCCTATTTCTCGAGAAATAGGATGCCTGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144632.3-1155s21c1
Sequence:CCGGGGTCGCAAAGGCCTGATAATACTCGAGTATTATCAGGCCTTTGCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-502s21c1
Sequence:CCGGCTATGACTCTGCAGTTATTTACTCGAGTAAATAACTGCAGAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-820s21c1
Sequence:CCGGTTTGCTAGCTGGATTACTATTCTCGAGAATAGTAATCCAGCTAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-352s21c1
Sequence:CCGGCTTCTGGAGGTGTTGGTTTAACTCGAGTTAAACCAACACCTCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144632.2-1774s1c1
Sequence:CCGGCCCTGCTTTATTAAAGACCATCTCGAGATGGTCTTTAATAAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_144632.2-786s1c1
Sequence:CCGGGCTGGATTACTATTTCTGGTTCTCGAGAACCAGAAATAGTAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_144632.2-522s1c1
Sequence:CCGGGCTGTAGTCATCGCAAGCTTTCTCGAGAAAGCTTGCGATGACTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_144632.2-727s1c1
Sequence:CCGGCTGTTCTGTATGGCTGGTCATCTCGAGATGACCAGCCATACAGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144632.2-339s1c1
Sequence:CCGGGTGGAAGAGAATGACTCCAATCTCGAGATTGGAGTCATTCTCTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144632
VALIDATED
TMEM182 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 182
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-669s21c1
Sequence:CCGGCATTGGTGGTGATGCTGTATGCTCGAGCATACAGCATCACCACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-647s21c1
Sequence:CCGGATTGCTGCAGGCATCCTATTTCTCGAGAAATAGGATGCCTGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144632.3-1155s21c1
Sequence:CCGGGGTCGCAAAGGCCTGATAATACTCGAGTATTATCAGGCCTTTGCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-502s21c1
Sequence:CCGGCTATGACTCTGCAGTTATTTACTCGAGTAAATAACTGCAGAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-820s21c1
Sequence:CCGGTTTGCTAGCTGGATTACTATTCTCGAGAATAGTAATCCAGCTAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-352s21c1
Sequence:CCGGCTTCTGGAGGTGTTGGTTTAACTCGAGTTAAACCAACACCTCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144632.2-1774s1c1
Sequence:CCGGCCCTGCTTTATTAAAGACCATCTCGAGATGGTCTTTAATAAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_144632.2-786s1c1
Sequence:CCGGGCTGGATTACTATTTCTGGTTCTCGAGAACCAGAAATAGTAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_144632.2-522s1c1
Sequence:CCGGGCTGTAGTCATCGCAAGCTTTCTCGAGAAAGCTTGCGATGACTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_144632.2-727s1c1
Sequence:CCGGCTGTTCTGTATGGCTGGTCATCTCGAGATGACCAGCCATACAGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144632.2-339s1c1
Sequence:CCGGGTGGAAGAGAATGACTCCAATCTCGAGATTGGAGTCATTCTCTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144632
VALIDATED
TMEM182 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 182
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-669s21c1
Sequence:CCGGCATTGGTGGTGATGCTGTATGCTCGAGCATACAGCATCACCACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-647s21c1
Sequence:CCGGATTGCTGCAGGCATCCTATTTCTCGAGAAATAGGATGCCTGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144632.3-1155s21c1
Sequence:CCGGGGTCGCAAAGGCCTGATAATACTCGAGTATTATCAGGCCTTTGCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-502s21c1
Sequence:CCGGCTATGACTCTGCAGTTATTTACTCGAGTAAATAACTGCAGAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-820s21c1
Sequence:CCGGTTTGCTAGCTGGATTACTATTCTCGAGAATAGTAATCCAGCTAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144632.3-352s21c1
Sequence:CCGGCTTCTGGAGGTGTTGGTTTAACTCGAGTTAAACCAACACCTCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144632.2-1774s1c1
Sequence:CCGGCCCTGCTTTATTAAAGACCATCTCGAGATGGTCTTTAATAAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_144632.2-786s1c1
Sequence:CCGGGCTGGATTACTATTTCTGGTTCTCGAGAACCAGAAATAGTAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_144632.2-522s1c1
Sequence:CCGGGCTGTAGTCATCGCAAGCTTTCTCGAGAAAGCTTGCGATGACTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_144632.2-727s1c1
Sequence:CCGGCTGTTCTGTATGGCTGGTCATCTCGAGATGACCAGCCATACAGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144632.2-339s1c1
Sequence:CCGGGTGGAAGAGAATGACTCCAATCTCGAGATTGGAGTCATTCTCTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081198
TMEM182 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 182
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-469s21c1
Sequence:CCGGCCTACGACTCCGCAATTATTTCTCGAGAAATAATTGCGGAGTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-809s21c1
Sequence:CCGGTCTAGTTGTTGGACGGCATATCTCGAGATATGCCGTCCAACAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081198.1-909s21c1
Sequence:CCGGTAGCAATGGTATTGGCATAAACTCGAGTTTATGCCAATACCATTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-222s21c1
Sequence:CCGGGTAGCCTTTGGATCGGATTATCTCGAGATAATCCGATCCAAAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-598s21c1
Sequence:CCGGCTGGAGGAGGCTCATACATTGCTCGAGCAATGTATGAGCCTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081198
TMEM182 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 182
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-469s21c1
Sequence:CCGGCCTACGACTCCGCAATTATTTCTCGAGAAATAATTGCGGAGTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-809s21c1
Sequence:CCGGTCTAGTTGTTGGACGGCATATCTCGAGATATGCCGTCCAACAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081198.1-909s21c1
Sequence:CCGGTAGCAATGGTATTGGCATAAACTCGAGTTTATGCCAATACCATTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-222s21c1
Sequence:CCGGGTAGCCTTTGGATCGGATTATCTCGAGATAATCCGATCCAAAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-598s21c1
Sequence:CCGGCTGGAGGAGGCTCATACATTGCTCGAGCAATGTATGAGCCTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081198
TMEM182 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 182
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-469s21c1
Sequence:CCGGCCTACGACTCCGCAATTATTTCTCGAGAAATAATTGCGGAGTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-809s21c1
Sequence:CCGGTCTAGTTGTTGGACGGCATATCTCGAGATATGCCGTCCAACAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081198.1-909s21c1
Sequence:CCGGTAGCAATGGTATTGGCATAAACTCGAGTTTATGCCAATACCATTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-222s21c1
Sequence:CCGGGTAGCCTTTGGATCGGATTATCTCGAGATAATCCGATCCAAAGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081198.1-598s21c1
Sequence:CCGGCTGGAGGAGGCTCATACATTGCTCGAGCAATGTATGAGCCTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks