EMAIL THIS PAGE TO A FRIEND

TMEM183A

transmembrane protein 183A

Synonyms: C1orf37
UniProtKB ID: Q8IXX5, A8K5W1, Q6NW15, Q96E06
Gene ID:
Mouse(57439) transmembrane protein 183A
Rat(289034) transmembrane protein 183A
Zebrafish(541482) transmembrane protein 183A
Horse(100065104) transmembrane protein 183A
chicken(421156) transmembrane protein 183A
dog(479994) transmembrane protein 183-like
domestic cat(101100026) transmembrane protein 183A
domestic guinea pig(100728162) transmembrane protein 183A
naked mole-rat(101706703) transmembrane protein 183A
Domestic Rabbit(100339667) transmembrane protein 183A
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138391 Rosetta Predictions human pricing
NM_001013871 Rosetta Predictions rat pricing
NM_001042485 Rosetta Predictions mouse pricing
NM_020588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167145 predicted 1268
2 SASI_Hs01_00167146 predicted 814
3 SASI_Hs01_00167147 predicted 467
4 SASI_Hs02_00363532 predicted 342
5 SASI_Hs01_00167148 predicted 900
6 SASI_Hs01_00167149 predicted 992
7 SASI_Hs01_00167150 predicted 472
8 SASI_Hs01_00167151 predicted 748
9 SASI_Hs01_00167152 predicted 967
10 SASI_Hs01_00167153 predicted 1003
11 SASI_Hs01_00167154 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032907 predicted 1196
2 SASI_Rn01_00032908 predicted 783
3 SASI_Rn01_00032909 predicted 1201
4 SASI_Rn01_00032910 predicted 731
5 SASI_Rn01_00032911 predicted 985
6 SASI_Rn01_00032912 predicted 324
7 SASI_Rn01_00032913 predicted 560
8 SASI_Rn02_00201141 predicted 434
9 SASI_Rn01_00032914 predicted 959
10 SASI_Rn01_00032915 predicted 460
11 SASI_Rn01_00032916 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290405 predicted 1224
2 SASI_Mm02_00290406 predicted 1144
3 SASI_Mm02_00290407 predicted 935
4 SASI_Mm02_00290408 predicted 1071
5 SASI_Mm02_00290409 predicted 807
6 SASI_Mm02_00290410 predicted 1277
7 SASI_Mm02_00290411 predicted 872
8 SASI_Mm02_00290412 predicted 1234
9 SASI_Mm02_00290413 predicted 1046
10 SASI_Mm02_00290414 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052173 predicted 1227
2 SASI_Mm02_00325680 predicted 1138
3 SASI_Mm02_00325681 predicted 940
4 SASI_Mm02_00325682 predicted 1070
5 SASI_Mm01_00052178 predicted 811
6 SASI_Mm02_00325683 predicted 1279
7 SASI_Mm02_00325684 predicted 868
8 SASI_Mm02_00325685 predicted 1235
9 SASI_Mm01_00052180 predicted 1048
10 SASI_Mm02_00325686 predicted 1243
11 SASI_Mm01_00052174 predicted 835
12 SASI_Mm01_00052175 predicted 471
13 SASI_Mm01_00052176 predicted 374
14 SASI_Mm01_00052177 predicted 818
15 SASI_Mm01_00052179 predicted 386
16 SASI_Mm01_00052181 predicted 512
17 SASI_Mm01_00052182 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138391
VALIDATED
TMEM183A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 183A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138391.3-837s1c1
Sequence:CCGGGCAGAAAGATTGTTGGGAACACTCGAGTGTTCCCAACAATCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-1380s1c1
Sequence:CCGGGAGGGAGAAATGTTGAATCAACTCGAGTTGATTCAACATTTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-1274s1c1
Sequence:CCGGCGAGTGTAGTCCATTAGTAATCTCGAGATTACTAATGGACTACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-947s1c1
Sequence:CCGGGTTCAGTACGAAGATGTTCATCTCGAGATGAACATCTTCGTACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138391.3-1706s1c1
Sequence:CCGGCCAGAAATAAAGCAGGTGACACTCGAGTGTCACCTGCTTTATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-1029s1c1
Sequence:CCGGCGATTGTCATGGGAATGATATCTCGAGATATCATTCCCATGACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-474s21c1
Sequence:CCGGGCTATTGCTGGCCTCCTATATCTCGAGATATAGGAGGCCAGCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-953s21c1
Sequence:CCGGCCACCCTCAATTTCATCTTTACTCGAGTAAAGATGAAATTGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-1328s21c1
Sequence:CCGGGAGGGAGAAATGTTGAATCAACTCGAGTTGATTCAACATTTCTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-977s21c1
Sequence:CCGGCGATTGTCATGGGAATGATATCTCGAGATATCATTCCCATGACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-895s21c1
Sequence:CCGGGTTCAGTACGAAGATGTTCATCTCGAGATGAACATCTTCGTACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138391
VALIDATED
TMEM183A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 183A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138391.3-837s1c1
Sequence:CCGGGCAGAAAGATTGTTGGGAACACTCGAGTGTTCCCAACAATCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-1380s1c1
Sequence:CCGGGAGGGAGAAATGTTGAATCAACTCGAGTTGATTCAACATTTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-1274s1c1
Sequence:CCGGCGAGTGTAGTCCATTAGTAATCTCGAGATTACTAATGGACTACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-947s1c1
Sequence:CCGGGTTCAGTACGAAGATGTTCATCTCGAGATGAACATCTTCGTACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138391.3-1706s1c1
Sequence:CCGGCCAGAAATAAAGCAGGTGACACTCGAGTGTCACCTGCTTTATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-1029s1c1
Sequence:CCGGCGATTGTCATGGGAATGATATCTCGAGATATCATTCCCATGACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-474s21c1
Sequence:CCGGGCTATTGCTGGCCTCCTATATCTCGAGATATAGGAGGCCAGCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-953s21c1
Sequence:CCGGCCACCCTCAATTTCATCTTTACTCGAGTAAAGATGAAATTGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-1328s21c1
Sequence:CCGGGAGGGAGAAATGTTGAATCAACTCGAGTTGATTCAACATTTCTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-977s21c1
Sequence:CCGGCGATTGTCATGGGAATGATATCTCGAGATATCATTCCCATGACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-895s21c1
Sequence:CCGGGTTCAGTACGAAGATGTTCATCTCGAGATGAACATCTTCGTACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138391
VALIDATED
TMEM183A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 183A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138391.3-837s1c1
Sequence:CCGGGCAGAAAGATTGTTGGGAACACTCGAGTGTTCCCAACAATCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-1380s1c1
Sequence:CCGGGAGGGAGAAATGTTGAATCAACTCGAGTTGATTCAACATTTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-1274s1c1
Sequence:CCGGCGAGTGTAGTCCATTAGTAATCTCGAGATTACTAATGGACTACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-947s1c1
Sequence:CCGGGTTCAGTACGAAGATGTTCATCTCGAGATGAACATCTTCGTACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138391.3-1706s1c1
Sequence:CCGGCCAGAAATAAAGCAGGTGACACTCGAGTGTCACCTGCTTTATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138391.3-1029s1c1
Sequence:CCGGCGATTGTCATGGGAATGATATCTCGAGATATCATTCCCATGACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-474s21c1
Sequence:CCGGGCTATTGCTGGCCTCCTATATCTCGAGATATAGGAGGCCAGCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-953s21c1
Sequence:CCGGCCACCCTCAATTTCATCTTTACTCGAGTAAAGATGAAATTGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-1328s21c1
Sequence:CCGGGAGGGAGAAATGTTGAATCAACTCGAGTTGATTCAACATTTCTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-977s21c1
Sequence:CCGGCGATTGTCATGGGAATGATATCTCGAGATATCATTCCCATGACAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138391.4-895s21c1
Sequence:CCGGGTTCAGTACGAAGATGTTCATCTCGAGATGAACATCTTCGTACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020588
VALIDATED
TMEM183A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 183A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020588.1-2231s1c1
Sequence:CCGGGCAGCCTTCAAATAGAGCAATCTCGAGATTGCTCTATTTGAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020588.1-841s1c1
Sequence:CCGGGTGGGAGTTCAACTTCAAGTTCTCGAGAACTTGAAGTTGAACTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020588.1-1616s1c1
Sequence:CCGGGCTCCTCAAATTCAAGTGAATCTCGAGATTCACTTGAATTTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020588.1-689s1c1
Sequence:CCGGGTGATCCGATCTCTGTATCATCTCGAGATGATACAGAGATCGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020588
VALIDATED
TMEM183A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 183A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020588.1-2231s1c1
Sequence:CCGGGCAGCCTTCAAATAGAGCAATCTCGAGATTGCTCTATTTGAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020588.1-841s1c1
Sequence:CCGGGTGGGAGTTCAACTTCAAGTTCTCGAGAACTTGAAGTTGAACTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020588.1-1616s1c1
Sequence:CCGGGCTCCTCAAATTCAAGTGAATCTCGAGATTCACTTGAATTTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020588.1-689s1c1
Sequence:CCGGGTGATCCGATCTCTGTATCATCTCGAGATGATACAGAGATCGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020588
VALIDATED
TMEM183A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 183A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020588.1-2231s1c1
Sequence:CCGGGCAGCCTTCAAATAGAGCAATCTCGAGATTGCTCTATTTGAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020588.1-841s1c1
Sequence:CCGGGTGGGAGTTCAACTTCAAGTTCTCGAGAACTTGAAGTTGAACTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020588.1-1616s1c1
Sequence:CCGGGCTCCTCAAATTCAAGTGAATCTCGAGATTCACTTGAATTTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020588.1-689s1c1
Sequence:CCGGGTGATCCGATCTCTGTATCATCTCGAGATGATACAGAGATCGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks