EMAIL THIS PAGE TO A FRIEND

TMEM183B

transmembrane protein 183B

Synonyms: C1orf37-DUP
Species: Human TMEM183B(653659)
UniProtKB ID: Q1AE95, Q1AE97
Gene ID:
Human(653659) Summary: This locus was thought to represent a pseudogene of chromosome 1 open reading frame 37 because it is intronless and retains a polyA tail at the 3' end. It does however contain a complete open reading frame that subsequent research has demonstrated to be transcribed in a limited number of human tissues. The encoded protein may represent a transmembrane protein associated with cell membranes and be involved in cell-cell or cell-environment interactions. [provided by RefSeq, Jul 2010]
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301273 ANTI-TMEM183B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079809 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079809 Rosetta Predictions human pricing
XM_930412 Rosetta Predictions human pricing
XM_934746 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313760 predicted 1266
2 SASI_Hs02_00313761 predicted 814
3 SASI_Hs02_00313762 predicted 467
4 SASI_Hs02_00313763 predicted 894
5 SASI_Hs02_00313764 predicted 986
6 SASI_Hs02_00313765 predicted 464
7 SASI_Hs02_00313766 predicted 744
8 SASI_Hs02_00313767 predicted 966
9 SASI_Hs02_00313768 predicted 1006
10 SASI_Hs02_00313769 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270887 predicted 1461
2 SASI_Hs01_00270888 predicted 1013
3 SASI_Hs01_00270889 predicted 658
4 SASI_Hs01_00270890 predicted 1094
5 SASI_Hs01_00270891 predicted 1187
6 SASI_Hs01_00270892 predicted 661
7 SASI_Hs01_00270893 predicted 933
8 SASI_Hs01_00270894 predicted 1163
9 SASI_Hs01_00270895 predicted 371
10 SASI_Hs01_00270896 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261167 predicted 666
2 SASI_Hs01_00261168 predicted 366
3 SASI_Hs01_00261169 predicted 667
4 SASI_Hs01_00261170 predicted 987
5 SASI_Hs01_00261171 predicted 1056
6 SASI_Hs01_00261172 predicted 667
7 SASI_Hs01_00261173 predicted 1056
8 SASI_Hs01_00261174 predicted 371
9 SASI_Hs01_00261175 predicted 1091
10 SASI_Hs01_00261176 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079809
VALIDATED
TMEM183B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 183B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000255395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-667s21c1
Sequence:CCGGGATCCGATCTCTGTACCATATCTCGAGATATGGTACAGAGATCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-1445s21c1
Sequence:CCGGGCTATTGAGTTTGTTCTTTATCTCGAGATAAAGAACAAACTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-1173s21c1
Sequence:CCGGTCTCCCTGAGAGCGTAGTTACCTCGAGGTAACTACGCTCTCAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-996s21c1
Sequence:CCGGTTACTCTGTTTACTATCAATGCTCGAGCATTGATAGTAAACAGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079809
VALIDATED
TMEM183B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 183B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000255395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-667s21c1
Sequence:CCGGGATCCGATCTCTGTACCATATCTCGAGATATGGTACAGAGATCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-1445s21c1
Sequence:CCGGGCTATTGAGTTTGTTCTTTATCTCGAGATAAAGAACAAACTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-1173s21c1
Sequence:CCGGTCTCCCTGAGAGCGTAGTTACCTCGAGGTAACTACGCTCTCAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-996s21c1
Sequence:CCGGTTACTCTGTTTACTATCAATGCTCGAGCATTGATAGTAAACAGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079809
VALIDATED
TMEM183B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 183B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000255395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-667s21c1
Sequence:CCGGGATCCGATCTCTGTACCATATCTCGAGATATGGTACAGAGATCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-1445s21c1
Sequence:CCGGGCTATTGAGTTTGTTCTTTATCTCGAGATAAAGAACAAACTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-1173s21c1
Sequence:CCGGTCTCCCTGAGAGCGTAGTTACCTCGAGGTAACTACGCTCTCAGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001079809.1-996s21c1
Sequence:CCGGTTACTCTGTTTACTATCAATGCTCGAGCATTGATAGTAAACAGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks