EMAIL THIS PAGE TO A FRIEND

TMEM184A

transmembrane protein 184A

UniProtKB ID: Q6ZMB5, Q8TBQ6
Gene ID:
Mouse(231832) transmembrane protein 184a
Rat(304325) transmembrane protein 184A
Zebrafish(406841) transmembrane protein 184a
chicken(769655) transmembrane protein 184A
dog(489896) transmembrane protein 184A
domestic cat(101090068) transmembrane protein 184A
cow(524484) transmembrane protein 184A
sheep(101113904) transmembrane protein 184A
naked mole-rat(101708842) transmembrane protein 184A
domestic guinea pig(100735281) transmembrane protein 184A
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001097620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097620 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152689 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055241 MISSION® esiRNA esiRNA targeting mouse Tmem184a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097620 Rosetta Predictions human pricing
NM_152689 Rosetta Predictions human pricing
NM_001025413 Rosetta Predictions rat pricing
NM_144914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318460 predicted 1915
2 SASI_Hs02_00318461 predicted 547
3 SASI_Hs02_00318462 predicted 783
4 SASI_Hs02_00318463 predicted 690
5 SASI_Hs02_00318464 predicted 694
6 SASI_Hs02_00318465 predicted 844
7 SASI_Hs02_00318466 predicted 1075
8 SASI_Hs02_00318467 predicted 908
9 SASI_Hs02_00318468 predicted 712
10 SASI_Hs02_00318469 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114466 predicted 3291
2 SASI_Hs01_00114467 predicted 1719
3 SASI_Hs01_00114468 predicted 2043
4 SASI_Hs01_00114469 predicted 3367
5 SASI_Hs01_00114470 predicted 2047
6 SASI_Hs01_00114471 predicted 2042
7 SASI_Hs01_00114472 predicted 3401
8 SASI_Hs01_00114473 predicted 3397
9 SASI_Hs01_00114474 predicted 3060
10 SASI_Hs01_00114475 predicted 2254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100363 predicted 522
2 SASI_Rn01_00100364 predicted 765
3 SASI_Rn01_00100365 predicted 604
4 SASI_Rn01_00100366 predicted 460
5 SASI_Rn02_00203147 predicted 391
6 SASI_Rn01_00100368 predicted 349
7 SASI_Rn01_00100369 predicted 695
8 SASI_Rn01_00100370 predicted 1123
9 SASI_Rn02_00203148 predicted 711
10 SASI_Rn02_00203149 predicted 774
11 SASI_Rn01_00100361 predicted 490
12 SASI_Rn01_00100362 predicted 404
13 SASI_Rn01_00100367 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112034 predicted 723
2 SASI_Mm01_00112035 predicted 577
3 SASI_Mm01_00112036 predicted 1258
4 SASI_Mm01_00112037 predicted 542
5 SASI_Mm01_00112039 predicted 1266
6 SASI_Mm01_00112040 predicted 287
7 SASI_Mm02_00340396 predicted 659
8 SASI_Mm01_00112041 predicted 1405
9 SASI_Mm01_00112042 predicted 707
10 SASI_Mm01_00112043 predicted 400
11 SASI_Mm01_00112038 predicted 1230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144914
TMEM184A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 184A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144914.3-1482s21c1
Sequence:CCCGGTGAAGTCACCTGGGCAAATTCTCGAGAATTTGCCCAGGTGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144914.3-1077s21c1
Sequence:CCGGAGCACCTATGCAAAGCATATCCTCGAGGATATGCTTTGCATAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144914.2-1215s1c1
Sequence:CCGGCAGCACCTATGCAAAGCATATCTCGAGATATGCTTTGCATAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144914.2-766s1c1
Sequence:CCGGCTGCATTGTGAAACCCGTTATCTCGAGATAACGGGTTTCACAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-1429s1c1
Sequence:CCGGCATAGAGAAACGCATGCTGATCTCGAGATCAGCATGCGTTTCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144914.2-1861s1c1
Sequence:CCGGCCCTTGCATTCTAACCTAGAACTCGAGTTCTAGGTTAGAATGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144914.2-1276s1c1
Sequence:CCGGCCAGGACGCCATTCATAACTTCTCGAGAAGTTATGAATGGCGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-721s1c1
Sequence:CCGGCTCCATCACGTTCTTACGCTTCTCGAGAAGCGTAAGAACGTGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-569s1c1
Sequence:CCGGCGAGACTGCTACGAAGCATTTCTCGAGAAATGCTTCGTAGCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-574s1c1
Sequence:CCGGCTGCTACGAAGCATTTGTCATCTCGAGATGACAAATGCTTCGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144914
TMEM184A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 184A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144914.3-1482s21c1
Sequence:CCCGGTGAAGTCACCTGGGCAAATTCTCGAGAATTTGCCCAGGTGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144914.3-1077s21c1
Sequence:CCGGAGCACCTATGCAAAGCATATCCTCGAGGATATGCTTTGCATAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144914.2-1215s1c1
Sequence:CCGGCAGCACCTATGCAAAGCATATCTCGAGATATGCTTTGCATAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144914.2-766s1c1
Sequence:CCGGCTGCATTGTGAAACCCGTTATCTCGAGATAACGGGTTTCACAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-1429s1c1
Sequence:CCGGCATAGAGAAACGCATGCTGATCTCGAGATCAGCATGCGTTTCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144914.2-1861s1c1
Sequence:CCGGCCCTTGCATTCTAACCTAGAACTCGAGTTCTAGGTTAGAATGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144914.2-1276s1c1
Sequence:CCGGCCAGGACGCCATTCATAACTTCTCGAGAAGTTATGAATGGCGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-721s1c1
Sequence:CCGGCTCCATCACGTTCTTACGCTTCTCGAGAAGCGTAAGAACGTGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-569s1c1
Sequence:CCGGCGAGACTGCTACGAAGCATTTCTCGAGAAATGCTTCGTAGCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-574s1c1
Sequence:CCGGCTGCTACGAAGCATTTGTCATCTCGAGATGACAAATGCTTCGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144914
TMEM184A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 184A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144914.3-1482s21c1
Sequence:CCCGGTGAAGTCACCTGGGCAAATTCTCGAGAATTTGCCCAGGTGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144914.3-1077s21c1
Sequence:CCGGAGCACCTATGCAAAGCATATCCTCGAGGATATGCTTTGCATAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144914.2-1215s1c1
Sequence:CCGGCAGCACCTATGCAAAGCATATCTCGAGATATGCTTTGCATAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144914.2-766s1c1
Sequence:CCGGCTGCATTGTGAAACCCGTTATCTCGAGATAACGGGTTTCACAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-1429s1c1
Sequence:CCGGCATAGAGAAACGCATGCTGATCTCGAGATCAGCATGCGTTTCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144914.2-1861s1c1
Sequence:CCGGCCCTTGCATTCTAACCTAGAACTCGAGTTCTAGGTTAGAATGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144914.2-1276s1c1
Sequence:CCGGCCAGGACGCCATTCATAACTTCTCGAGAAGTTATGAATGGCGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-721s1c1
Sequence:CCGGCTCCATCACGTTCTTACGCTTCTCGAGAAGCGTAAGAACGTGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-569s1c1
Sequence:CCGGCGAGACTGCTACGAAGCATTTCTCGAGAAATGCTTCGTAGCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144914.2-574s1c1
Sequence:CCGGCTGCTACGAAGCATTTGTCATCTCGAGATGACAAATGCTTCGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097620
TMEM184A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 184A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-923s21c1
Sequence:CCGGCCTCCAGGCATTTGGCAAATACTCGAGTATTTGCCAAATGCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-1084s21c1
Sequence:CCGGTCAAGTTCCTCACCATCAAAGCTCGAGCTTTGATGGTGAGGAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-696s21c1
Sequence:CCGGTACGAAGCCTTTGTCATTTACCTCGAGGTAAATGACAAAGGCTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-523s21c1
Sequence:CCGGTCACCTGCCACCAGATCTATCCTCGAGGATAGATCTGGTGGCAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097620.1-2237s21c1
Sequence:CCGGGGCTGTGGGAATCGCTCTTATCTCGAGATAAGAGCGATTCCCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097620
TMEM184A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 184A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-923s21c1
Sequence:CCGGCCTCCAGGCATTTGGCAAATACTCGAGTATTTGCCAAATGCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-1084s21c1
Sequence:CCGGTCAAGTTCCTCACCATCAAAGCTCGAGCTTTGATGGTGAGGAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-696s21c1
Sequence:CCGGTACGAAGCCTTTGTCATTTACCTCGAGGTAAATGACAAAGGCTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-523s21c1
Sequence:CCGGTCACCTGCCACCAGATCTATCCTCGAGGATAGATCTGGTGGCAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097620.1-2237s21c1
Sequence:CCGGGGCTGTGGGAATCGCTCTTATCTCGAGATAAGAGCGATTCCCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097620
TMEM184A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 184A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-923s21c1
Sequence:CCGGCCTCCAGGCATTTGGCAAATACTCGAGTATTTGCCAAATGCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-1084s21c1
Sequence:CCGGTCAAGTTCCTCACCATCAAAGCTCGAGCTTTGATGGTGAGGAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-696s21c1
Sequence:CCGGTACGAAGCCTTTGTCATTTACCTCGAGGTAAATGACAAAGGCTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097620.1-523s21c1
Sequence:CCGGTCACCTGCCACCAGATCTATCCTCGAGGATAGATCTGGTGGCAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097620.1-2237s21c1
Sequence:CCGGGGCTGTGGGAATCGCTCTTATCTCGAGATAAGAGCGATTCCCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152689
TMEM184A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 184A
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000181214    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152689.2-3919s1c1
Sequence:CCGGCAGTATCCTTCTCTGGGAGATCTCGAGATCTCCCAGAGAAGGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152689
TMEM184A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 184A
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000181214    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152689.2-3919s1c1
Sequence:CCGGCAGTATCCTTCTCTGGGAGATCTCGAGATCTCCCAGAGAAGGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152689
TMEM184A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 184A
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000181214    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152689.2-3919s1c1
Sequence:CCGGCAGTATCCTTCTCTGGGAGATCTCGAGATCTCCCAGAGAAGGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks