EMAIL THIS PAGE TO A FRIEND

TMEM184B

transmembrane protein 184B

Synonyms: C22orf5 FM08 HS5O6A
Gene ID:
Mouse(223693) transmembrane protein 184b
Rat(362959) transmembrane protein 184B
domestic guinea pig(100727222) transmembrane protein 184B
naked mole-rat(101709475) transmembrane protein 184B
cow(514220) transmembrane protein 184B
sheep(101104227) transmembrane protein 184B
Zebrafish(792833) transmembrane protein 184b
chicken(418027) transmembrane protein 184B
domestic cat(101101066) transmembrane protein 184B
Horse(100070012) transmembrane protein 184B
dog(481254) transmembrane protein 184B
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012264 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012264 Rosetta Predictions human pricing
XM_001076493 Rosetta Predictions rat pricing
XM_343289 Rosetta Predictions rat pricing
NM_172608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023470 predicted 1508
2 SASI_Hs01_00023471 predicted 800
3 SASI_Hs01_00023472 predicted 1497
4 SASI_Hs01_00023473 predicted 1868
5 SASI_Hs01_00023474 predicted 318
6 SASI_Hs01_00023475 predicted 1119
7 SASI_Hs01_00023476 predicted 710
8 SASI_Hs01_00023477 predicted 1642
9 SASI_Hs01_00023478 predicted 735
10 SASI_Hs01_00023479 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353439 predicted 1543
2 SASI_Rn02_00353440 predicted 539
3 SASI_Rn02_00353441 predicted 1377
4 SASI_Rn02_00353442 predicted 1128
5 SASI_Rn02_00353443 predicted 1758
6 SASI_Rn02_00353444 predicted 1822
7 SASI_Rn02_00353445 predicted 1021
8 SASI_Rn02_00353446 predicted 1798
9 SASI_Rn02_00353447 predicted 757
10 SASI_Rn02_00353448 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395593 predicted 1547
2 SASI_Rn02_00395594 predicted 540
3 SASI_Rn02_00395595 predicted 1375
4 SASI_Rn02_00395596 predicted 1129
5 SASI_Rn02_00395597 predicted 1761
6 SASI_Rn02_00395598 predicted 1828
7 SASI_Rn02_00395599 predicted 1017
8 SASI_Rn02_00395600 predicted 1794
9 SASI_Rn02_00395601 predicted 759
10 SASI_Rn02_00395602 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044654 predicted 525
2 SASI_Mm01_00044655 predicted 1618
3 SASI_Mm01_00044656 predicted 1120
4 SASI_Mm01_00044657 predicted 614
5 SASI_Mm01_00044658 predicted 1799
6 SASI_Mm01_00044659 predicted 1334
7 SASI_Mm01_00044660 predicted 1197
8 SASI_Mm01_00044661 predicted 767
9 SASI_Mm01_00044662 predicted 1374
10 SASI_Mm01_00044663 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172608
VALIDATED
TMEM184B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 184B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172608.1-3066s1c1
Sequence:CCGGCGTTCTTTCTTCCCATTCTTTCTCGAGAAAGAATGGGAAGAAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172608.1-1191s1c1
Sequence:CCGGCAGCCTCAAAGAGACCATGAACTCGAGTTCATGGTCTCTTTGAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172608.1-807s1c1
Sequence:CCGGGTACCTCTACGTGACCATCATCTCGAGATGATGGTCACGTAGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-928s21c1
Sequence:CCGGATGGTCAAGTCCGTCATATTCCTCGAGGAATATGACGGACTTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-1204s21c1
Sequence:CCGGACCATGAACCCACACGATATTCTCGAGAATATCGTGTGGGTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-1501s21c1
Sequence:CCGGTTGGACCAGAAACTCGCATATCTCGAGATATGCGAGTTTCTGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-531s21c1
Sequence:CCGGTGAGGCCTTTGTCATCTATAACTCGAGTTATAGATGACAAAGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-736s21c1
Sequence:CCGGATGGCCGTCAGCACCGTTATACTCGAGTATAACGGTGCTGACGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172608
VALIDATED
TMEM184B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 184B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172608.1-3066s1c1
Sequence:CCGGCGTTCTTTCTTCCCATTCTTTCTCGAGAAAGAATGGGAAGAAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172608.1-1191s1c1
Sequence:CCGGCAGCCTCAAAGAGACCATGAACTCGAGTTCATGGTCTCTTTGAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172608.1-807s1c1
Sequence:CCGGGTACCTCTACGTGACCATCATCTCGAGATGATGGTCACGTAGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-928s21c1
Sequence:CCGGATGGTCAAGTCCGTCATATTCCTCGAGGAATATGACGGACTTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-1204s21c1
Sequence:CCGGACCATGAACCCACACGATATTCTCGAGAATATCGTGTGGGTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-1501s21c1
Sequence:CCGGTTGGACCAGAAACTCGCATATCTCGAGATATGCGAGTTTCTGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-531s21c1
Sequence:CCGGTGAGGCCTTTGTCATCTATAACTCGAGTTATAGATGACAAAGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-736s21c1
Sequence:CCGGATGGCCGTCAGCACCGTTATACTCGAGTATAACGGTGCTGACGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172608
VALIDATED
TMEM184B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 184B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172608.1-3066s1c1
Sequence:CCGGCGTTCTTTCTTCCCATTCTTTCTCGAGAAAGAATGGGAAGAAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172608.1-1191s1c1
Sequence:CCGGCAGCCTCAAAGAGACCATGAACTCGAGTTCATGGTCTCTTTGAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172608.1-807s1c1
Sequence:CCGGGTACCTCTACGTGACCATCATCTCGAGATGATGGTCACGTAGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-928s21c1
Sequence:CCGGATGGTCAAGTCCGTCATATTCCTCGAGGAATATGACGGACTTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-1204s21c1
Sequence:CCGGACCATGAACCCACACGATATTCTCGAGAATATCGTGTGGGTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-1501s21c1
Sequence:CCGGTTGGACCAGAAACTCGCATATCTCGAGATATGCGAGTTTCTGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-531s21c1
Sequence:CCGGTGAGGCCTTTGTCATCTATAACTCGAGTTATAGATGACAAAGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172608.1-736s21c1
Sequence:CCGGATGGCCGTCAGCACCGTTATACTCGAGTATAACGGTGCTGACGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012264
TMEM184B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 184B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-585s1c1
Sequence:CCGGCATGTCGGAGATCAGAGGAAACTCGAGTTTCCTCTGATCTCCGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-474s1c1
Sequence:CCGGCAACGACCAGTACTACGTGTACTCGAGTACACGTAGTACTGGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-662s1c1
Sequence:CCGGCCATCGGATTTCTGAGGTTCTCTCGAGAGAACCTCAGAAATCCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-909s1c1
Sequence:CCGGGTTCTTCATGGTCAAGTCCGTCTCGAGACGGACTTGACCATGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012264.2-930s1c1
Sequence:CCGGCATCTTTCTTTCCTTCTGGCACTCGAGTGCCAGAAGGAAAGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012264.2-804s1c1
Sequence:CCGGCGTGACCATCATCTACAACATCTCGAGATGTTGTAGATGATGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012264.2-903s1c1
Sequence:CCGGCCTCAAGTTCTTCATGGTCAACTCGAGTTGACCATGAAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-650s1c1
Sequence:CCGGGAAAGACTTATTCCATCGGATCTCGAGATCCGATGGAATAAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012264.3-1646s21c1
Sequence:CCGGGACACTGGGAGCAAGGCTTATCTCGAGATAAGCCTTGCTCCCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012264.3-1587s21c1
Sequence:CCGGATGGGCCTTCAGGAATATTTACTCGAGTAAATATTCCTGAAGGCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012264
TMEM184B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 184B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-585s1c1
Sequence:CCGGCATGTCGGAGATCAGAGGAAACTCGAGTTTCCTCTGATCTCCGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-474s1c1
Sequence:CCGGCAACGACCAGTACTACGTGTACTCGAGTACACGTAGTACTGGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-662s1c1
Sequence:CCGGCCATCGGATTTCTGAGGTTCTCTCGAGAGAACCTCAGAAATCCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-909s1c1
Sequence:CCGGGTTCTTCATGGTCAAGTCCGTCTCGAGACGGACTTGACCATGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012264.2-930s1c1
Sequence:CCGGCATCTTTCTTTCCTTCTGGCACTCGAGTGCCAGAAGGAAAGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012264.2-804s1c1
Sequence:CCGGCGTGACCATCATCTACAACATCTCGAGATGTTGTAGATGATGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012264.2-903s1c1
Sequence:CCGGCCTCAAGTTCTTCATGGTCAACTCGAGTTGACCATGAAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-650s1c1
Sequence:CCGGGAAAGACTTATTCCATCGGATCTCGAGATCCGATGGAATAAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012264.3-1646s21c1
Sequence:CCGGGACACTGGGAGCAAGGCTTATCTCGAGATAAGCCTTGCTCCCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012264.3-1587s21c1
Sequence:CCGGATGGGCCTTCAGGAATATTTACTCGAGTAAATATTCCTGAAGGCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012264
TMEM184B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 184B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-585s1c1
Sequence:CCGGCATGTCGGAGATCAGAGGAAACTCGAGTTTCCTCTGATCTCCGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-474s1c1
Sequence:CCGGCAACGACCAGTACTACGTGTACTCGAGTACACGTAGTACTGGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-662s1c1
Sequence:CCGGCCATCGGATTTCTGAGGTTCTCTCGAGAGAACCTCAGAAATCCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-909s1c1
Sequence:CCGGGTTCTTCATGGTCAAGTCCGTCTCGAGACGGACTTGACCATGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012264.2-930s1c1
Sequence:CCGGCATCTTTCTTTCCTTCTGGCACTCGAGTGCCAGAAGGAAAGAAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012264.2-804s1c1
Sequence:CCGGCGTGACCATCATCTACAACATCTCGAGATGTTGTAGATGATGGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012264.2-903s1c1
Sequence:CCGGCCTCAAGTTCTTCATGGTCAACTCGAGTTGACCATGAAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012264.2-650s1c1
Sequence:CCGGGAAAGACTTATTCCATCGGATCTCGAGATCCGATGGAATAAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012264.3-1646s21c1
Sequence:CCGGGACACTGGGAGCAAGGCTTATCTCGAGATAAGCCTTGCTCCCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012264.3-1587s21c1
Sequence:CCGGATGGGCCTTCAGGAATATTTACTCGAGTAAATATTCCTGAAGGCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks