EMAIL THIS PAGE TO A FRIEND

TMEM184C

transmembrane protein 184C

Synonyms: TMEM34
UniProtKB ID: Q9NVA4, D3DP04, Q86X84, Q969I7, Q9NXM2
Gene ID:
Mouse(234463) transmembrane protein 184C
Rat(291946) transmembrane protein 184C
Zebrafish(567248) transmembrane protein 184C
domestic cat(101083166) transmembrane protein 184C
dog(475459) transmembrane protein 184C
chicken(422469) transmembrane protein 184C
cow(504966) transmembrane protein 184C
sheep(101108340) transmembrane protein 184C
naked mole-rat(101724937) transmembrane protein 184C
Domestic Rabbit(100338254) transmembrane protein 184C
domestic guinea pig(100722847) transmembrane protein 184C
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500158 Anti-TMEM184C antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA054013 Anti-TMEM184C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018241 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018241 Rosetta Predictions human pricing
NM_178330 Rosetta Predictions rat pricing
NM_145599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351585 predicted 753
2 SASI_Hs01_00130951 predicted 926
3 SASI_Hs01_00130953 predicted 1020
4 SASI_Hs01_00130954 predicted 1761
5 SASI_Hs01_00130955 predicted 1334
6 SASI_Hs01_00130956 predicted 1817
7 SASI_Hs02_00351586 predicted 813
8 SASI_Hs01_00130957 predicted 1847
9 SASI_Hs01_00130958 predicted 1425
10 SASI_Hs01_00130959 predicted 1003
11 SASI_Hs01_00130952 predicted 1760
12 SASI_Hs01_00130960 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068969 predicted 1040
2 SASI_Rn01_00068970 predicted 597
3 SASI_Rn02_00269639 predicted 1845
4 SASI_Rn01_00068971 predicted 806
5 SASI_Rn01_00068973 predicted 1458
6 SASI_Rn02_00269640 predicted 708
7 SASI_Rn01_00068974 predicted 1198
8 SASI_Rn01_00068975 predicted 1727
9 SASI_Rn01_00068976 predicted 1172
10 SASI_Rn01_00068977 predicted 800
11 SASI_Rn01_00068972 predicted 884
12 SASI_Rn01_00068978 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069522 predicted 524
2 SASI_Mm01_00069523 predicted 649
3 SASI_Mm01_00069525 predicted 1690
4 SASI_Mm01_00069526 predicted 748
5 SASI_Mm01_00069527 predicted 1539
6 SASI_Mm01_00069528 predicted 1023
7 SASI_Mm02_00341145 predicted 1113
8 SASI_Mm01_00069529 predicted 1298
9 SASI_Mm01_00069530 predicted 1794
10 SASI_Mm01_00069531 predicted 512
11 SASI_Mm01_00069524 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018241
VALIDATED
TMEM184C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 184C
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018241.2-599s21c1
Sequence:CCGGGAGACAGTGGATTCGACCTTTCTCGAGAAAGGTCGAATCCACTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018241.2-1572s21c1
Sequence:CCGGGATGTCTCAGATATTAGAGATCTCGAGATCTCTAATATCTGAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018241.2-2632s21c1
Sequence:CCGGCCTCAACTGAATGTCTTTCAACTCGAGTTGAAAGACATTCAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018241.2-2006s21c1
Sequence:CCGGGCCAGGTACAACTACTGCATTCTCGAGAATGCAGTAGTTGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-618s1c1
Sequence:CCGGGAATTACAGAAACTGGAGGTTCTCGAGAACCTCCAGTTTCTGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-884s1c1
Sequence:CCGGCTTTATGGGATTCCTTACCAACTCGAGTTGGTAAGGAATCCCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-2574s1c1
Sequence:CCGGCCTCAACTGAATGTCTTTCAACTCGAGTTGAAAGACATTCAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-917s1c1
Sequence:CCGGCCGGTATCCAAATCTGGTATTCTCGAGAATACCAGATTTGGATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-1949s1c1
Sequence:CCGGGCCAGGTACAACTACTGCATTCTCGAGAATGCAGTAGTTGTACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-542s1c1
Sequence:CCGGGAGACAGTGGATTCGACCTTTCTCGAGAAAGGTCGAATCCACTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-1736s1c1
Sequence:CCGGGACTACACCTACCACAGCTAACTCGAGTTAGCTGTGGTAGGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-1515s1c1
Sequence:CCGGGATGTCTCAGATATTAGAGATCTCGAGATCTCTAATATCTGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-1804s1c1
Sequence:CCGGCTTCAGATAAATCCGTGGATTCTCGAGAATCCACGGATTTATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018241
VALIDATED
TMEM184C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 184C
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018241.2-599s21c1
Sequence:CCGGGAGACAGTGGATTCGACCTTTCTCGAGAAAGGTCGAATCCACTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018241.2-1572s21c1
Sequence:CCGGGATGTCTCAGATATTAGAGATCTCGAGATCTCTAATATCTGAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018241.2-2632s21c1
Sequence:CCGGCCTCAACTGAATGTCTTTCAACTCGAGTTGAAAGACATTCAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018241.2-2006s21c1
Sequence:CCGGGCCAGGTACAACTACTGCATTCTCGAGAATGCAGTAGTTGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-618s1c1
Sequence:CCGGGAATTACAGAAACTGGAGGTTCTCGAGAACCTCCAGTTTCTGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-884s1c1
Sequence:CCGGCTTTATGGGATTCCTTACCAACTCGAGTTGGTAAGGAATCCCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-2574s1c1
Sequence:CCGGCCTCAACTGAATGTCTTTCAACTCGAGTTGAAAGACATTCAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-917s1c1
Sequence:CCGGCCGGTATCCAAATCTGGTATTCTCGAGAATACCAGATTTGGATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-1949s1c1
Sequence:CCGGGCCAGGTACAACTACTGCATTCTCGAGAATGCAGTAGTTGTACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-542s1c1
Sequence:CCGGGAGACAGTGGATTCGACCTTTCTCGAGAAAGGTCGAATCCACTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-1736s1c1
Sequence:CCGGGACTACACCTACCACAGCTAACTCGAGTTAGCTGTGGTAGGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-1515s1c1
Sequence:CCGGGATGTCTCAGATATTAGAGATCTCGAGATCTCTAATATCTGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-1804s1c1
Sequence:CCGGCTTCAGATAAATCCGTGGATTCTCGAGAATCCACGGATTTATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018241
VALIDATED
TMEM184C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 184C
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018241.2-599s21c1
Sequence:CCGGGAGACAGTGGATTCGACCTTTCTCGAGAAAGGTCGAATCCACTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018241.2-1572s21c1
Sequence:CCGGGATGTCTCAGATATTAGAGATCTCGAGATCTCTAATATCTGAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018241.2-2632s21c1
Sequence:CCGGCCTCAACTGAATGTCTTTCAACTCGAGTTGAAAGACATTCAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018241.2-2006s21c1
Sequence:CCGGGCCAGGTACAACTACTGCATTCTCGAGAATGCAGTAGTTGTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-618s1c1
Sequence:CCGGGAATTACAGAAACTGGAGGTTCTCGAGAACCTCCAGTTTCTGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-884s1c1
Sequence:CCGGCTTTATGGGATTCCTTACCAACTCGAGTTGGTAAGGAATCCCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-2574s1c1
Sequence:CCGGCCTCAACTGAATGTCTTTCAACTCGAGTTGAAAGACATTCAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-917s1c1
Sequence:CCGGCCGGTATCCAAATCTGGTATTCTCGAGAATACCAGATTTGGATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-1949s1c1
Sequence:CCGGGCCAGGTACAACTACTGCATTCTCGAGAATGCAGTAGTTGTACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-542s1c1
Sequence:CCGGGAGACAGTGGATTCGACCTTTCTCGAGAAAGGTCGAATCCACTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-1736s1c1
Sequence:CCGGGACTACACCTACCACAGCTAACTCGAGTTAGCTGTGGTAGGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018241.1-1515s1c1
Sequence:CCGGGATGTCTCAGATATTAGAGATCTCGAGATCTCTAATATCTGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018241.1-1804s1c1
Sequence:CCGGCTTCAGATAAATCCGTGGATTCTCGAGAATCCACGGATTTATCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145599
VALIDATED
TMEM184C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 184C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-1199s21c1
Sequence:CCGGTGGTTAAACTGGGCGTTATTTCTCGAGAAATAACGCCCAGTTTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-1026s21c1
Sequence:CCGGGACATACCTCGTTATACTAAACTCGAGTTTAGTATAACGAGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-2343s21c1
Sequence:CCGGTACTAATAACGCACATGTTAACTCGAGTTAACATGTGCGTTATTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-1322s21c1
Sequence:CCGGACTATACGTTCTCCTATAAACCTCGAGGTTTATAGGAGAACGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-746s21c1
Sequence:CCGGACGAAGCTTACGTCATCTATACTCGAGTATAGATGACGTAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145599.2-1793s1c1
Sequence:CCGGCCAATTTCTATAGCCAGCATACTCGAGTATGCTGGCTATAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145599.2-2268s1c1
Sequence:CCGGGCTGACATGTTAGCTCAAGATCTCGAGATCTTGAGCTAACATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145599.2-752s1c1
Sequence:CCGGGCTTACGTCATCTATAACTTTCTCGAGAAAGTTATAGATGACGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145599
VALIDATED
TMEM184C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 184C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-1199s21c1
Sequence:CCGGTGGTTAAACTGGGCGTTATTTCTCGAGAAATAACGCCCAGTTTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-1026s21c1
Sequence:CCGGGACATACCTCGTTATACTAAACTCGAGTTTAGTATAACGAGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-2343s21c1
Sequence:CCGGTACTAATAACGCACATGTTAACTCGAGTTAACATGTGCGTTATTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-1322s21c1
Sequence:CCGGACTATACGTTCTCCTATAAACCTCGAGGTTTATAGGAGAACGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-746s21c1
Sequence:CCGGACGAAGCTTACGTCATCTATACTCGAGTATAGATGACGTAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145599.2-1793s1c1
Sequence:CCGGCCAATTTCTATAGCCAGCATACTCGAGTATGCTGGCTATAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145599.2-2268s1c1
Sequence:CCGGGCTGACATGTTAGCTCAAGATCTCGAGATCTTGAGCTAACATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145599.2-752s1c1
Sequence:CCGGGCTTACGTCATCTATAACTTTCTCGAGAAAGTTATAGATGACGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145599
VALIDATED
TMEM184C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 184C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-1199s21c1
Sequence:CCGGTGGTTAAACTGGGCGTTATTTCTCGAGAAATAACGCCCAGTTTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-1026s21c1
Sequence:CCGGGACATACCTCGTTATACTAAACTCGAGTTTAGTATAACGAGGTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-2343s21c1
Sequence:CCGGTACTAATAACGCACATGTTAACTCGAGTTAACATGTGCGTTATTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-1322s21c1
Sequence:CCGGACTATACGTTCTCCTATAAACCTCGAGGTTTATAGGAGAACGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145599.3-746s21c1
Sequence:CCGGACGAAGCTTACGTCATCTATACTCGAGTATAGATGACGTAAGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145599.2-1793s1c1
Sequence:CCGGCCAATTTCTATAGCCAGCATACTCGAGTATGCTGGCTATAGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145599.2-2268s1c1
Sequence:CCGGGCTGACATGTTAGCTCAAGATCTCGAGATCTTGAGCTAACATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145599.2-752s1c1
Sequence:CCGGGCTTACGTCATCTATAACTTTCTCGAGAAAGTTATAGATGACGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks