EMAIL THIS PAGE TO A FRIEND

TMEM185A

transmembrane protein 185A

Synonyms: CXorf13 FAM11A FRAXF ee3
UniProtKB ID: Q8NFB2, B3KTZ3, Q3SYH1, Q96CW3, Q96KE8
Gene ID:
Human(84548) Summary: The protein encoded by this gene is predicted to be a transmembrane protein, but this has not been experimentally determined. This gene is better known for localizing to the CpG island of the fragile site FRAXF. The 5-prime untranslated region of this gene contains a CGG trinucleotide repeat sequence that normally consists of 7-40 tandem CGG repeats but which can expand to greater than 300 repeats. Methylation of the CpG island leads to transcriptional silencing of this gene, but neither the silencing nor an expanded repeat region appear to manifest itself in a clear phenotypic manner. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
Rat(309357) transmembrane protein 185A
domestic guinea pig(100724700) transmembrane protein 185A
naked mole-rat(101710946) transmembrane protein 185A
cow(541149) transmembrane protein 185A
sheep(101121921) transmembrane protein 185A
chicken(422391) transmembrane protein 185A
dog(481072) transmembrane protein 185A
domestic cat(101093254) transmembrane protein 185A
Horse(100069905) transmembrane protein 185A
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032508 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000551 MISSION® esiRNA esiRNA targeting human TMEM185A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032508 Rosetta Predictions human pricing
XM_001053713 Rosetta Predictions rat pricing
XM_219837 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236101 predicted 745
2 SASI_Hs01_00236102 predicted 533
3 SASI_Hs02_00359996 predicted 644
4 SASI_Hs02_00359997 predicted 630
5 SASI_Hs01_00236103 predicted 1113
6 SASI_Hs01_00236105 predicted 711
7 SASI_Hs01_00236106 predicted 728
8 SASI_Hs01_00236107 predicted 751
9 SASI_Hs01_00236108 predicted 898
10 SASI_Hs01_00236109 predicted 704
11 SASI_Hs01_00236104 predicted 1093
12 SASI_Hs01_00236110 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273300 predicted 755
2 SASI_Rn02_00273301 predicted 600
3 SASI_Rn02_00273302 predicted 380
4 SASI_Rn02_00273303 predicted 770
5 SASI_Rn02_00273304 predicted 1048
6 SASI_Rn02_00273305 predicted 389
7 SASI_Rn02_00273306 predicted 781
8 SASI_Rn02_00273307 predicted 611
9 SASI_Rn02_00273308 predicted 605
10 SASI_Rn02_00273309 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378759 predicted 752
2 SASI_Rn02_00378760 predicted 597
3 SASI_Rn02_00378761 predicted 380
4 SASI_Rn02_00378762 predicted 774
5 SASI_Rn02_00378763 predicted 1047
6 SASI_Rn02_00378764 predicted 385
7 SASI_Rn02_00378765 predicted 788
8 SASI_Rn02_00378766 predicted 609
9 SASI_Rn02_00378767 predicted 599
10 SASI_Rn02_00378768 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032508
VALIDATED
TMEM185A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 185A
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-1688s1c1
Sequence:CCGGCCCAGAAGGAACATCTGTCTACTCGAGTAGACAGATGTTCCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-1134s1c1
Sequence:CCGGCGCAAAGATTTCTGTCAGTTTCTCGAGAAACTGACAGAAATCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-456s1c1
Sequence:CCGGCTGTGGAAGTTAATGGTCATTCTCGAGAATGACCATTAACTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-764s1c1
Sequence:CCGGCCAGTTTATATTCATTGCCTTCTCGAGAAGGCAATGAATATAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-1332s1c1
Sequence:CCGGCCTCCCAAATTAAATATCGAACTCGAGTTCGATATTTAATTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-2324s1c1
Sequence:CCGGGCCGGAACACTAGAGAATGTTCTCGAGAACATTCTCTAGTGTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-1265s1c1
Sequence:CCGGCGCACCCATGTTTCGAAAGAACTCGAGTTCTTTCGAAACATGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-455s1c1
Sequence:CCGGGCTGTGGAAGTTAATGGTCATCTCGAGATGACCATTAACTTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-878s1c1
Sequence:CCGGCATTGTGTGGTCCGTCTTGTTCTCGAGAACAAGACGGACCACACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-1033s21c1
Sequence:CCGGTCTCCTGCATCCCGATCTTTGCTCGAGCAAAGATCGGGATGCAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-718s21c1
Sequence:CCGGATGACAGGTCACTAGAGTTAGCTCGAGCTAACTCTAGTGACCTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-433s21c1
Sequence:CCGGGGGCTGTCTTTGCTCCAATATCTCGAGATATTGGAGCAAAGACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-655s21c1
Sequence:CCGGTCTTCATGCCGCTGTTCTTTGCTCGAGCAAAGAACAGCGGCATGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-686s21c1
Sequence:CCGGGTCTGTTGCAGCTTGCGTTTGCTCGAGCAAACGCAAGCTGCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-400s21c1
Sequence:CCGGTTCGTTTGGATGGCATCATACCTCGAGGTATGATGCCATCCAAACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032508
VALIDATED
TMEM185A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 185A
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-1688s1c1
Sequence:CCGGCCCAGAAGGAACATCTGTCTACTCGAGTAGACAGATGTTCCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-1134s1c1
Sequence:CCGGCGCAAAGATTTCTGTCAGTTTCTCGAGAAACTGACAGAAATCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-456s1c1
Sequence:CCGGCTGTGGAAGTTAATGGTCATTCTCGAGAATGACCATTAACTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-764s1c1
Sequence:CCGGCCAGTTTATATTCATTGCCTTCTCGAGAAGGCAATGAATATAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-1332s1c1
Sequence:CCGGCCTCCCAAATTAAATATCGAACTCGAGTTCGATATTTAATTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-2324s1c1
Sequence:CCGGGCCGGAACACTAGAGAATGTTCTCGAGAACATTCTCTAGTGTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-1265s1c1
Sequence:CCGGCGCACCCATGTTTCGAAAGAACTCGAGTTCTTTCGAAACATGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-455s1c1
Sequence:CCGGGCTGTGGAAGTTAATGGTCATCTCGAGATGACCATTAACTTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-878s1c1
Sequence:CCGGCATTGTGTGGTCCGTCTTGTTCTCGAGAACAAGACGGACCACACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-1033s21c1
Sequence:CCGGTCTCCTGCATCCCGATCTTTGCTCGAGCAAAGATCGGGATGCAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-718s21c1
Sequence:CCGGATGACAGGTCACTAGAGTTAGCTCGAGCTAACTCTAGTGACCTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-433s21c1
Sequence:CCGGGGGCTGTCTTTGCTCCAATATCTCGAGATATTGGAGCAAAGACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-655s21c1
Sequence:CCGGTCTTCATGCCGCTGTTCTTTGCTCGAGCAAAGAACAGCGGCATGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-686s21c1
Sequence:CCGGGTCTGTTGCAGCTTGCGTTTGCTCGAGCAAACGCAAGCTGCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-400s21c1
Sequence:CCGGTTCGTTTGGATGGCATCATACCTCGAGGTATGATGCCATCCAAACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032508
VALIDATED
TMEM185A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 185A
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-1688s1c1
Sequence:CCGGCCCAGAAGGAACATCTGTCTACTCGAGTAGACAGATGTTCCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-1134s1c1
Sequence:CCGGCGCAAAGATTTCTGTCAGTTTCTCGAGAAACTGACAGAAATCTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-456s1c1
Sequence:CCGGCTGTGGAAGTTAATGGTCATTCTCGAGAATGACCATTAACTTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-764s1c1
Sequence:CCGGCCAGTTTATATTCATTGCCTTCTCGAGAAGGCAATGAATATAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-1332s1c1
Sequence:CCGGCCTCCCAAATTAAATATCGAACTCGAGTTCGATATTTAATTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-2324s1c1
Sequence:CCGGGCCGGAACACTAGAGAATGTTCTCGAGAACATTCTCTAGTGTTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-1265s1c1
Sequence:CCGGCGCACCCATGTTTCGAAAGAACTCGAGTTCTTTCGAAACATGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032508.1-455s1c1
Sequence:CCGGGCTGTGGAAGTTAATGGTCATCTCGAGATGACCATTAACTTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032508.1-878s1c1
Sequence:CCGGCATTGTGTGGTCCGTCTTGTTCTCGAGAACAAGACGGACCACACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-1033s21c1
Sequence:CCGGTCTCCTGCATCCCGATCTTTGCTCGAGCAAAGATCGGGATGCAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-718s21c1
Sequence:CCGGATGACAGGTCACTAGAGTTAGCTCGAGCTAACTCTAGTGACCTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-433s21c1
Sequence:CCGGGGGCTGTCTTTGCTCCAATATCTCGAGATATTGGAGCAAAGACAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-655s21c1
Sequence:CCGGTCTTCATGCCGCTGTTCTTTGCTCGAGCAAAGAACAGCGGCATGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-686s21c1
Sequence:CCGGGTCTGTTGCAGCTTGCGTTTGCTCGAGCAAACGCAAGCTGCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032508.1-400s21c1
Sequence:CCGGTTCGTTTGGATGGCATCATACCTCGAGGTATGATGCCATCCAAACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks