EMAIL THIS PAGE TO A FRIEND

TMEM185B

transmembrane protein 185B

Synonyms: FAM11B
UniProtKB ID: Q9H7F4, A8K1G5, Q53T33, Q66K44, Q8IZ77
Gene ID:
Mouse(226351) transmembrane protein 185B
Rat(304731) transmembrane protein 185B
Horse(100060238) transmembrane protein 185B
domestic cat(101080727) transmembrane protein 185B
dog(476112) transmembrane protein 185B
cow(526189) transmembrane protein 185B
naked mole-rat(101699610) transmembrane protein 185B
domestic guinea pig(100714810) transmembrane protein 185B
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_000034 Rosetta Predictions human pricing
XM_001053834 Rosetta Predictions rat pricing
XM_222559 Rosetta Predictions rat pricing
NM_146103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_000034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374522 predicted 892
2 SASI_Hs02_00374523 predicted 1063
3 SASI_Hs02_00374524 predicted 857
4 SASI_Hs02_00374525 predicted 1755
5 SASI_Hs02_00374526 predicted 1053
6 SASI_Hs02_00374527 predicted 895
7 SASI_Hs02_00374528 predicted 522
8 SASI_Hs02_00374529 predicted 1658
9 SASI_Hs02_00374530 predicted 1684
10 SASI_Hs02_00374531 predicted 1894
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273744 predicted 628
2 SASI_Rn02_00273745 predicted 1148
3 SASI_Rn02_00273746 predicted 580
4 SASI_Rn02_00273747 predicted 1808
5 SASI_Rn02_00273748 predicted 1046
6 SASI_Rn02_00273749 predicted 1804
7 SASI_Rn02_00273750 predicted 771
8 SASI_Rn02_00273751 predicted 820
9 SASI_Rn02_00273752 predicted 1066
10 SASI_Rn02_00273753 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380795 predicted 632
2 SASI_Rn02_00380796 predicted 1144
3 SASI_Rn02_00380797 predicted 576
4 SASI_Rn02_00380798 predicted 1816
5 SASI_Rn02_00380799 predicted 1047
6 SASI_Rn02_00380800 predicted 1797
7 SASI_Rn02_00380801 predicted 778
8 SASI_Rn02_00380802 predicted 823
9 SASI_Rn02_00380803 predicted 1067
10 SASI_Rn02_00380804 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039078 predicted 390
2 SASI_Mm01_00039079 predicted 878
3 SASI_Mm01_00039080 predicted 1404
4 SASI_Mm01_00039081 predicted 1436
5 SASI_Mm01_00039082 predicted 1053
6 SASI_Mm01_00039083 predicted 1430
7 SASI_Mm01_00039084 predicted 1364
8 SASI_Mm01_00039085 predicted 442
9 SASI_Mm01_00039086 predicted 1223
10 SASI_Mm01_00039087 predicted 1308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146103
VALIDATED
TMEM185B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 185B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146103.1-744s21c1
Sequence:CCGGTTCCGACACGACAGGTCTTTGCTCGAGCAAAGACCTGTCGTGTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146103.1-1358s21c1
Sequence:CCGGGCCTCCACCTCCCAAGTTAAACTCGAGTTTAACTTGGGAGGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146103.1-1757s21c1
Sequence:CCGGTTTATACACTGCTAGTCTAAACTCGAGTTTAGACTAGCAGTGTATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146103.1-1057s21c1
Sequence:CCGGACAATACGTTCTCTTACATTTCTCGAGAAATGTAAGAGAACGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146103.1-1056s1c1
Sequence:CCGGCACAATACGTTCTCTTACATTCTCGAGAATGTAAGAGAACGTATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146103
VALIDATED
TMEM185B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 185B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146103.1-744s21c1
Sequence:CCGGTTCCGACACGACAGGTCTTTGCTCGAGCAAAGACCTGTCGTGTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146103.1-1358s21c1
Sequence:CCGGGCCTCCACCTCCCAAGTTAAACTCGAGTTTAACTTGGGAGGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146103.1-1757s21c1
Sequence:CCGGTTTATACACTGCTAGTCTAAACTCGAGTTTAGACTAGCAGTGTATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146103.1-1057s21c1
Sequence:CCGGACAATACGTTCTCTTACATTTCTCGAGAAATGTAAGAGAACGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146103.1-1056s1c1
Sequence:CCGGCACAATACGTTCTCTTACATTCTCGAGAATGTAAGAGAACGTATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146103
VALIDATED
TMEM185B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 185B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146103.1-744s21c1
Sequence:CCGGTTCCGACACGACAGGTCTTTGCTCGAGCAAAGACCTGTCGTGTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146103.1-1358s21c1
Sequence:CCGGGCCTCCACCTCCCAAGTTAAACTCGAGTTTAACTTGGGAGGTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146103.1-1757s21c1
Sequence:CCGGTTTATACACTGCTAGTCTAAACTCGAGTTTAGACTAGCAGTGTATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146103.1-1057s21c1
Sequence:CCGGACAATACGTTCTCTTACATTTCTCGAGAAATGTAAGAGAACGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146103.1-1056s1c1
Sequence:CCGGCACAATACGTTCTCTTACATTCTCGAGAATGTAAGAGAACGTATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks