EMAIL THIS PAGE TO A FRIEND

TMEM186

transmembrane protein 186

Synonyms: C16orf51
UniProtKB ID: Q96B77, B2RAY0, Q9Y4T4
Gene ID:
Human(25880) Summary: This gene encodes a potential transmembrane protein. [provided by RefSeq, Dec 2012]
Mouse(66690) transmembrane protein 186
Rat(497863) transmembrane protein 186
domestic guinea pig(100723866) transmembrane protein 186
naked mole-rat(101713436) transmembrane protein 186
cow(513552) transmembrane protein 186
sheep(101106052) transmembrane protein 186
chicken(416641) transmembrane protein 186
domestic cat(101090825) transmembrane protein 186
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015421 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015421 Rosetta Predictions human pricing
NM_001025756 Rosetta Predictions rat pricing
NM_025708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176030 predicted 474
2 SASI_Hs01_00176031 predicted 397
3 SASI_Hs01_00176032 predicted 389
4 SASI_Hs02_00347803 predicted 552
5 SASI_Hs01_00176034 predicted 348
6 SASI_Hs01_00176035 predicted 611
7 SASI_Hs01_00176036 predicted 224
8 SASI_Hs01_00176037 predicted 267
9 SASI_Hs01_00176038 predicted 305
10 SASI_Hs01_00176039 predicted 240
11 SASI_Hs01_00176033 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112951 predicted 607
2 SASI_Rn01_00112952 predicted 950
3 SASI_Rn01_00112953 predicted 774
4 SASI_Rn01_00112954 predicted 535
5 SASI_Rn01_00112955 predicted 1022
6 SASI_Rn02_00203424 predicted 704
7 SASI_Rn01_00112957 predicted 485
8 SASI_Rn01_00112958 predicted 1266
9 SASI_Rn01_00112959 predicted 322
10 SASI_Rn02_00203425 predicted 415
11 SASI_Rn01_00112956 predicted 462
12 SASI_Rn01_00112960 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025410 predicted 762
2 SASI_Mm01_00025411 predicted 363
3 SASI_Mm01_00025412 predicted 827
4 SASI_Mm01_00025413 predicted 1004
5 SASI_Mm01_00025414 predicted 1211
6 SASI_Mm01_00025415 predicted 470
7 SASI_Mm02_00328887 predicted 1357
8 SASI_Mm01_00025416 predicted 1121
9 SASI_Mm01_00025417 predicted 1182
10 SASI_Mm01_00025418 predicted 1303
11 SASI_Mm01_00025419 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025708
VALIDATED
TMEM186 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 186
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025708.1-600s1c1
Sequence:CCGGGCATCCTGTATGTGAACGAGTCTCGAGACTCGTTCACATACAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025708.1-719s1c1
Sequence:CCGGGAACGGGTTCAGGATGTGTTTCTCGAGAAACACATCCTGAACCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-397s21c1
Sequence:CCGGTTCCGAGCCATCCGAGCAATTCTCGAGAATTGCTCGGATGGCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-781s21c1
Sequence:CCGGACCTTACGCTATGGCCGAATCCTCGAGGATTCGGCCATAGCGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-370s21c1
Sequence:CCGGACCGAAACATTCCATACAATCCTCGAGGATTGTATGGAATGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217005    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025708.4-1140s1c1
Sequence:CCGGCATAGGACATCCCATCATATACTCGAGTATATGATGGGATGTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025708.4-1796s1c1
Sequence:CCGGCACTTGCTTATTAGGTAATTGCTCGAGCAATTACCTAATAAGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025708.4-680s21c1
Sequence:CCGGGTGCCGTGTCAGACATGATACCTCGAGGTATCATGTCTGACACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-1141s21c1
Sequence:CCGGATAGGACATCCCATCATATAGCTCGAGCTATATGATGGGATGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025708
VALIDATED
TMEM186 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 186
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025708.1-600s1c1
Sequence:CCGGGCATCCTGTATGTGAACGAGTCTCGAGACTCGTTCACATACAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025708.1-719s1c1
Sequence:CCGGGAACGGGTTCAGGATGTGTTTCTCGAGAAACACATCCTGAACCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-397s21c1
Sequence:CCGGTTCCGAGCCATCCGAGCAATTCTCGAGAATTGCTCGGATGGCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-781s21c1
Sequence:CCGGACCTTACGCTATGGCCGAATCCTCGAGGATTCGGCCATAGCGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-370s21c1
Sequence:CCGGACCGAAACATTCCATACAATCCTCGAGGATTGTATGGAATGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217005    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025708.4-1140s1c1
Sequence:CCGGCATAGGACATCCCATCATATACTCGAGTATATGATGGGATGTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025708.4-1796s1c1
Sequence:CCGGCACTTGCTTATTAGGTAATTGCTCGAGCAATTACCTAATAAGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025708.4-680s21c1
Sequence:CCGGGTGCCGTGTCAGACATGATACCTCGAGGTATCATGTCTGACACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-1141s21c1
Sequence:CCGGATAGGACATCCCATCATATAGCTCGAGCTATATGATGGGATGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025708
VALIDATED
TMEM186 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 186
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025708.1-600s1c1
Sequence:CCGGGCATCCTGTATGTGAACGAGTCTCGAGACTCGTTCACATACAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025708.1-719s1c1
Sequence:CCGGGAACGGGTTCAGGATGTGTTTCTCGAGAAACACATCCTGAACCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-397s21c1
Sequence:CCGGTTCCGAGCCATCCGAGCAATTCTCGAGAATTGCTCGGATGGCTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-781s21c1
Sequence:CCGGACCTTACGCTATGGCCGAATCCTCGAGGATTCGGCCATAGCGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-370s21c1
Sequence:CCGGACCGAAACATTCCATACAATCCTCGAGGATTGTATGGAATGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217005    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025708.4-1140s1c1
Sequence:CCGGCATAGGACATCCCATCATATACTCGAGTATATGATGGGATGTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025708.4-1796s1c1
Sequence:CCGGCACTTGCTTATTAGGTAATTGCTCGAGCAATTACCTAATAAGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025708.4-680s21c1
Sequence:CCGGGTGCCGTGTCAGACATGATACCTCGAGGTATCATGTCTGACACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025708.4-1141s21c1
Sequence:CCGGATAGGACATCCCATCATATAGCTCGAGCTATATGATGGGATGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015421
VALIDATED
TMEM186 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 186
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015421.1-179s1c1
Sequence:CCGGGACTGAGAAATTCTGGATGTTCTCGAGAACATCCAGAATTTCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015421.1-1005s1c1
Sequence:CCGGGCATAAGATTTGGAGTCAGAACTCGAGTTCTGACTCCAAATCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015421.1-409s1c1
Sequence:CCGGGTATCCTGTATCTGAATGAGTCTCGAGACTCATTCAGATACAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015421.1-374s1c1
Sequence:CCGGGTGCTGGATGAGCTATTTCTTCTCGAGAAGAAATAGCTCATCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015421.1-922s1c1
Sequence:CCGGCCAGTTCTTAGAAGAACCTATCTCGAGATAGGTTCTTCTAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236367    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-844s21c1
Sequence:CCGGAGGCTCTAAGCAAGTTCTTACCTCGAGGTAAGAACTTGCTTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-367s21c1
Sequence:CCGGGCTGTGCTGGATGAGCTATTTCTCGAGAAATAGCTCATCCAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-396s21c1
Sequence:CCGGGACTGGTTGGTATCCTGTATCCTCGAGGATACAGGATACCAACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015421.2-486s21c1
Sequence:CCGGGTCCCATGGCAGATGTGATTCCTCGAGGAATCACATCTGCCATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-272s21c1
Sequence:CCGGGCTTTGCCACCAGGCTATTACCTCGAGGTAATAGCCTGGTGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015421
VALIDATED
TMEM186 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 186
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015421.1-179s1c1
Sequence:CCGGGACTGAGAAATTCTGGATGTTCTCGAGAACATCCAGAATTTCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015421.1-1005s1c1
Sequence:CCGGGCATAAGATTTGGAGTCAGAACTCGAGTTCTGACTCCAAATCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015421.1-409s1c1
Sequence:CCGGGTATCCTGTATCTGAATGAGTCTCGAGACTCATTCAGATACAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015421.1-374s1c1
Sequence:CCGGGTGCTGGATGAGCTATTTCTTCTCGAGAAGAAATAGCTCATCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015421.1-922s1c1
Sequence:CCGGCCAGTTCTTAGAAGAACCTATCTCGAGATAGGTTCTTCTAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236367    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-844s21c1
Sequence:CCGGAGGCTCTAAGCAAGTTCTTACCTCGAGGTAAGAACTTGCTTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-367s21c1
Sequence:CCGGGCTGTGCTGGATGAGCTATTTCTCGAGAAATAGCTCATCCAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-396s21c1
Sequence:CCGGGACTGGTTGGTATCCTGTATCCTCGAGGATACAGGATACCAACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015421.2-486s21c1
Sequence:CCGGGTCCCATGGCAGATGTGATTCCTCGAGGAATCACATCTGCCATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-272s21c1
Sequence:CCGGGCTTTGCCACCAGGCTATTACCTCGAGGTAATAGCCTGGTGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015421
VALIDATED
TMEM186 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 186
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015421.1-179s1c1
Sequence:CCGGGACTGAGAAATTCTGGATGTTCTCGAGAACATCCAGAATTTCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015421.1-1005s1c1
Sequence:CCGGGCATAAGATTTGGAGTCAGAACTCGAGTTCTGACTCCAAATCTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015421.1-409s1c1
Sequence:CCGGGTATCCTGTATCTGAATGAGTCTCGAGACTCATTCAGATACAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015421.1-374s1c1
Sequence:CCGGGTGCTGGATGAGCTATTTCTTCTCGAGAAGAAATAGCTCATCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015421.1-922s1c1
Sequence:CCGGCCAGTTCTTAGAAGAACCTATCTCGAGATAGGTTCTTCTAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236367    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-844s21c1
Sequence:CCGGAGGCTCTAAGCAAGTTCTTACCTCGAGGTAAGAACTTGCTTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-367s21c1
Sequence:CCGGGCTGTGCTGGATGAGCTATTTCTCGAGAAATAGCTCATCCAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-396s21c1
Sequence:CCGGGACTGGTTGGTATCCTGTATCCTCGAGGATACAGGATACCAACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015421.2-486s21c1
Sequence:CCGGGTCCCATGGCAGATGTGATTCCTCGAGGAATCACATCTGCCATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015421.2-272s21c1
Sequence:CCGGGCTTTGCCACCAGGCTATTACCTCGAGGTAATAGCCTGGTGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks