EMAIL THIS PAGE TO A FRIEND

TMEM187

transmembrane protein 187

Synonyms: CXorf12 DXS9878E ITBA1
UniProtKB ID: Q14656, B2RC47, Q6IAV7
Gene ID:
Human(8269) Summary: This gene consists of two exons and encodes a multi-pass membrane protein. An alternatively spliced transcript variant encoding the same protein has been found, but its biological validity is not determined. [provided by RefSeq, May 2010]
Zebrafish(100001485) transmembrane protein 187
domestic cat(101090246) transmembrane protein 187
dog(612536) transmembrane protein 187
cow(508380) transmembrane protein 187
sheep(101121665) transmembrane protein 187
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003492 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045431 MISSION® esiRNA esiRNA human TMEM187 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003492 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050550 predicted 1400
2 SASI_Hs01_00050551 predicted 944
3 SASI_Hs01_00050553 predicted 952
4 SASI_Hs01_00050554 predicted 689
5 SASI_Hs01_00050555 predicted 1405
6 SASI_Hs01_00050558 predicted 1232
7 SASI_Hs01_00050559 predicted 802
8 SASI_Hs02_00335771 predicted 1310
9 SASI_Hs02_00335772 predicted 1182
10 SASI_Hs02_00335773 predicted 1228
11 SASI_Hs01_00050552 predicted 1166
12 SASI_Hs01_00050556 predicted 1164
13 SASI_Hs01_00050557 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003492
VALIDATED
TMEM187 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 187
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-596s21c1
Sequence:CCGGTGGCTGTGTTCACGGGCATTTCTCGAGAAATGCCCGTGAACACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-1359s21c1
Sequence:CCGGCATTGAAATGGACTCTGAGATCTCGAGATCTCAGAGTCCATTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-1232s21c1
Sequence:CCGGACGTGCTCCAGTTCCACTTTGCTCGAGCAAAGTGGAACTGGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-1401s21c1
Sequence:CCGGGACATCCTGTGTGTGATGATACTCGAGTATCATCACACACAGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003492.2-699s21c1
Sequence:CCGGGTTCAACTCACTCGTGAACATCTCGAGATGTTCACGAGTGAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003492.1-1151s1c1
Sequence:CCGGGACATCCTGTGTGTGATGATACTCGAGTATCATCACACACAGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003492.1-449s1c1
Sequence:CCGGGTTCAACTCACTCGTGAACATCTCGAGATGTTCACGAGTGAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003492.1-1109s1c1
Sequence:CCGGCATTGAAATGGACTCTGAGATCTCGAGATCTCAGAGTCCATTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003492.1-1178s1c1
Sequence:CCGGGATTACACAAGACTGCCCTTTCTCGAGAAAGGGCAGTCTTGTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003492
VALIDATED
TMEM187 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 187
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-596s21c1
Sequence:CCGGTGGCTGTGTTCACGGGCATTTCTCGAGAAATGCCCGTGAACACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-1359s21c1
Sequence:CCGGCATTGAAATGGACTCTGAGATCTCGAGATCTCAGAGTCCATTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-1232s21c1
Sequence:CCGGACGTGCTCCAGTTCCACTTTGCTCGAGCAAAGTGGAACTGGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-1401s21c1
Sequence:CCGGGACATCCTGTGTGTGATGATACTCGAGTATCATCACACACAGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003492.2-699s21c1
Sequence:CCGGGTTCAACTCACTCGTGAACATCTCGAGATGTTCACGAGTGAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003492.1-1151s1c1
Sequence:CCGGGACATCCTGTGTGTGATGATACTCGAGTATCATCACACACAGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003492.1-449s1c1
Sequence:CCGGGTTCAACTCACTCGTGAACATCTCGAGATGTTCACGAGTGAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003492.1-1109s1c1
Sequence:CCGGCATTGAAATGGACTCTGAGATCTCGAGATCTCAGAGTCCATTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003492.1-1178s1c1
Sequence:CCGGGATTACACAAGACTGCCCTTTCTCGAGAAAGGGCAGTCTTGTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003492
VALIDATED
TMEM187 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 187
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-596s21c1
Sequence:CCGGTGGCTGTGTTCACGGGCATTTCTCGAGAAATGCCCGTGAACACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-1359s21c1
Sequence:CCGGCATTGAAATGGACTCTGAGATCTCGAGATCTCAGAGTCCATTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-1232s21c1
Sequence:CCGGACGTGCTCCAGTTCCACTTTGCTCGAGCAAAGTGGAACTGGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003492.2-1401s21c1
Sequence:CCGGGACATCCTGTGTGTGATGATACTCGAGTATCATCACACACAGGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003492.2-699s21c1
Sequence:CCGGGTTCAACTCACTCGTGAACATCTCGAGATGTTCACGAGTGAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003492.1-1151s1c1
Sequence:CCGGGACATCCTGTGTGTGATGATACTCGAGTATCATCACACACAGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003492.1-449s1c1
Sequence:CCGGGTTCAACTCACTCGTGAACATCTCGAGATGTTCACGAGTGAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003492.1-1109s1c1
Sequence:CCGGCATTGAAATGGACTCTGAGATCTCGAGATCTCAGAGTCCATTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003492.1-1178s1c1
Sequence:CCGGGATTACACAAGACTGCCCTTTCTCGAGAAAGGGCAGTCTTGTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks