EMAIL THIS PAGE TO A FRIEND

TMEM189-UBE2V1

TMEM189-UBE2V1 readthrough

Synonyms: CROC-1B CROC1B KUA-UEV
Gene ID:
Human(387522) Summary: The TMEM189-UEV mRNA is an infrequent but naturally occurring read-through transcript of the neighboring TMEM189 and UBE2V1 genes. Ubiquitin-conjugating E2 enzyme variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein produced by this transcript has UEV1 B domains but the protein is localized to the cytoplasm rather than to the nucleus. The significance of this read-through mRNA and the function of its protein product has not yet been determined. [provided by RefSeq, Oct 2010]
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300269 Anti-UBE2V (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_003349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003349 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096581 MISSION® esiRNA esiRNA human TMEM189 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003349 Rosetta Predictions human pricing
NM_199203 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245702 predicted 658
2 SASI_Hs01_00245709 predicted 992
3 SASI_Hs01_00245711 predicted 956
4 SASI_Hs01_00245703 predicted 972
5 SASI_Hs01_00245704 predicted 882
6 SASI_Hs01_00245705 predicted 981
7 SASI_Hs01_00245706 predicted 980
8 SASI_Hs01_00245707 predicted 873
9 SASI_Hs01_00245708 predicted 908
10 SASI_Hs01_00245710 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225284 predicted 1129
2 SASI_Hs01_00225291 predicted 1455
3 SASI_Hs01_00225293 predicted 1425
4 SASI_Hs01_00225285 predicted 1438
5 SASI_Hs01_00225286 predicted 1345
6 SASI_Hs01_00225287 predicted 1445
7 SASI_Hs01_00225288 predicted 1450
8 SASI_Hs01_00225289 predicted 1332
9 SASI_Hs01_00225290 predicted 1368
10 SASI_Hs01_00225292 predicted 1302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199203
TMEM189-UBE2V1 MISSION shRNA Bacterial Glycerol Stock
TMEM189-UBE2V1 readthrough
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000426763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199203.2-1035s21c1
Sequence:CCGGATAGAATGTGGACCTAAATACCTCGAGGTATTTAGGTCCACATTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199203.2-1545s21c1
Sequence:CCGGTAAATTGATTCCCATCATAACCTCGAGGTTATGATGGGAATCAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199203.2-1316s21c1
Sequence:CCGGCGATTTAATCAGTCTTCATTTCTCGAGAAATGAAGACTGATTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199203
TMEM189-UBE2V1 MISSION shRNA shRNA Plasmid DNA
TMEM189-UBE2V1 readthrough
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000426763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199203.2-1035s21c1
Sequence:CCGGATAGAATGTGGACCTAAATACCTCGAGGTATTTAGGTCCACATTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199203.2-1545s21c1
Sequence:CCGGTAAATTGATTCCCATCATAACCTCGAGGTTATGATGGGAATCAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199203.2-1316s21c1
Sequence:CCGGCGATTTAATCAGTCTTCATTTCTCGAGAAATGAAGACTGATTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199203
TMEM189-UBE2V1 MISSION shRNA Lentiviral Transduction Particles
TMEM189-UBE2V1 readthrough
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000426763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199203.2-1035s21c1
Sequence:CCGGATAGAATGTGGACCTAAATACCTCGAGGTATTTAGGTCCACATTCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199203.2-1545s21c1
Sequence:CCGGTAAATTGATTCCCATCATAACCTCGAGGTTATGATGGGAATCAATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199203.2-1316s21c1
Sequence:CCGGCGATTTAATCAGTCTTCATTTCTCGAGAAATGAAGACTGATTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003349
TMEM189-UBE2V1 MISSION shRNA Bacterial Glycerol Stock
TMEM189-UBE2V1 readthrough
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-153s1c1
Sequence:CCGGCTTCGGCACCTTCACCAACCACTCGAGTGGTTGGTGAAGGTGCCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003349.x-1361s1c1
Sequence:CCGGCTGAGATTGGCTTCGGTGAGGCTCGAGCCTCACCGAAGCCAATCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-249s1c1
Sequence:CCGGGCCACGTAAACACCATCGCATCTCGAGATGCGATGGTGTTTACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-190s1c1
Sequence:CCGGCACACGTACTTTGGGCTGCCACTCGAGTGGCAGCCCAAAGTACGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-292s1c1
Sequence:CCGGACCTACTTCTGCATCACCACACTCGAGTGTGGTGATGCAGAAGTAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003349
TMEM189-UBE2V1 MISSION shRNA shRNA Plasmid DNA
TMEM189-UBE2V1 readthrough
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-153s1c1
Sequence:CCGGCTTCGGCACCTTCACCAACCACTCGAGTGGTTGGTGAAGGTGCCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003349.x-1361s1c1
Sequence:CCGGCTGAGATTGGCTTCGGTGAGGCTCGAGCCTCACCGAAGCCAATCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-249s1c1
Sequence:CCGGGCCACGTAAACACCATCGCATCTCGAGATGCGATGGTGTTTACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-190s1c1
Sequence:CCGGCACACGTACTTTGGGCTGCCACTCGAGTGGCAGCCCAAAGTACGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-292s1c1
Sequence:CCGGACCTACTTCTGCATCACCACACTCGAGTGTGGTGATGCAGAAGTAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003349
TMEM189-UBE2V1 MISSION shRNA Lentiviral Transduction Particles
TMEM189-UBE2V1 readthrough
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-153s1c1
Sequence:CCGGCTTCGGCACCTTCACCAACCACTCGAGTGGTTGGTGAAGGTGCCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003349.x-1361s1c1
Sequence:CCGGCTGAGATTGGCTTCGGTGAGGCTCGAGCCTCACCGAAGCCAATCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-249s1c1
Sequence:CCGGGCCACGTAAACACCATCGCATCTCGAGATGCGATGGTGTTTACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-190s1c1
Sequence:CCGGCACACGTACTTTGGGCTGCCACTCGAGTGGCAGCCCAAAGTACGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003349.x-292s1c1
Sequence:CCGGACCTACTTCTGCATCACCACACTCGAGTGTGGTGATGCAGAAGTAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks