EMAIL THIS PAGE TO A FRIEND

TMEM189

transmembrane protein 189

Synonyms: KUA
UniProtKB ID: A5PLL7
Gene ID:
Human(387521) Summary: Co-transcription of this gene and the neighboring downstream gene (ubiquitin-conjugating enzyme E2 variant 1) generates a rare read-through transcript, which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. The protein encoded by this individual gene lacks a UEV1 domain but includes three transmembrane regions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Mouse(407243) transmembrane protein 189
Rat(362278) transmembrane protein 189
Zebrafish(450031) transmembrane protein 189
domestic cat(101081283) transmembrane protein 189
Horse(100071459) transmembrane protein 189
dog(611401) transmembrane protein 189
chicken(100538348) transmembrane protein 189
cow(507694) transmembrane protein 189
sheep(101117690) transmembrane protein 189
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T8953 Anti-TMEM189 (256-270) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199129 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093931 MISSION® esiRNA esiRNA targeting mouse Tmem189 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199129 Rosetta Predictions human pricing
NM_001113752 Rosetta Predictions rat pricing
NM_145538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098717 predicted 444
2 SASI_Hs01_00098718 predicted 198
3 SASI_Hs01_00098720 predicted 256
4 SASI_Hs01_00098721 predicted 460
5 SASI_Hs01_00098722 predicted 303
6 SASI_Hs01_00098723 predicted 458
7 SASI_Hs01_00098724 predicted 309
8 SASI_Hs01_00098725 predicted 529
9 SASI_Hs01_00098726 predicted 335
10 SASI_Hs02_00372561 predicted 333
11 SASI_Hs01_00098719 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251983 predicted 631
2 SASI_Rn02_00251984 predicted 812
3 SASI_Rn02_00251985 predicted 1116
4 SASI_Rn02_00251986 predicted 330
5 SASI_Rn02_00251987 predicted 390
6 SASI_Rn02_00251988 predicted 896
7 SASI_Rn02_00251989 predicted 857
8 SASI_Rn02_00251990 predicted 395
9 SASI_Rn02_00251991 predicted 797
10 SASI_Rn02_00251992 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129223 predicted 493
2 SASI_Mm01_00129225 predicted 484
3 SASI_Mm01_00129226 predicted 543
4 SASI_Mm01_00129227 predicted 709
5 SASI_Mm02_00341019 predicted 833
6 SASI_Mm02_00341020 predicted 365
7 SASI_Mm01_00129218 predicted 1221
8 SASI_Mm02_00341021 predicted 426
9 SASI_Mm01_00129219 predicted 1168
10 SASI_Mm01_00129220 predicted 1247
11 SASI_Mm01_00129221 predicted 880
12 SASI_Mm01_00129222 predicted 903
13 SASI_Mm01_00129224 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199129
VALIDATED
TMEM189 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 189
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199129.1-859s1c1
Sequence:CCGGCTCGGGCAGATGACATGAAATCTCGAGATTTCATGTCATCTGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199129.1-524s1c1
Sequence:CCGGGCTGCTAAACATGGCCTACAACTCGAGTTGTAGGCCATGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199129.1-309s1c1
Sequence:CCGGCTCGTCATACTCGGTGTTGTTCTCGAGAACAACACCGAGTATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199129.1-766s1c1
Sequence:CCGGGCATCACCACAGGCTGGCTCACTCGAGTGAGCCAGCCTGTGGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199129.1-869s1c1
Sequence:CCGGTGACATGAAATGGGCCCAGAACTCGAGTTCTGGGCCCATTTCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199129.2-968s21c1
Sequence:CCGGCAAATAACTTCTCCGAGCCTGCTCGAGCAGGCTCGGAGAAGTTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_199129.2-841s21c1
Sequence:CCGGGCATCACCACAGGCTGGCTCACTCGAGTGAGCCAGCCTGTGGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199129.2-934s21c1
Sequence:CCGGCTCGGGCAGATGACATGAAATCTCGAGATTTCATGTCATCTGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_199129.2-1021s21c1
Sequence:CCGGACCGAAGCCATCTGCCAAATTCTCGAGAATTTGGCAGATGGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_199129.2-864s21c1
Sequence:CCGGTACCCTCTGGAGAAGATAGGCCTCGAGGCCTATCTTCTCCAGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199129
VALIDATED
TMEM189 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 189
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199129.1-859s1c1
Sequence:CCGGCTCGGGCAGATGACATGAAATCTCGAGATTTCATGTCATCTGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199129.1-524s1c1
Sequence:CCGGGCTGCTAAACATGGCCTACAACTCGAGTTGTAGGCCATGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199129.1-309s1c1
Sequence:CCGGCTCGTCATACTCGGTGTTGTTCTCGAGAACAACACCGAGTATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199129.1-766s1c1
Sequence:CCGGGCATCACCACAGGCTGGCTCACTCGAGTGAGCCAGCCTGTGGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199129.1-869s1c1
Sequence:CCGGTGACATGAAATGGGCCCAGAACTCGAGTTCTGGGCCCATTTCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199129.2-968s21c1
Sequence:CCGGCAAATAACTTCTCCGAGCCTGCTCGAGCAGGCTCGGAGAAGTTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_199129.2-841s21c1
Sequence:CCGGGCATCACCACAGGCTGGCTCACTCGAGTGAGCCAGCCTGTGGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199129.2-934s21c1
Sequence:CCGGCTCGGGCAGATGACATGAAATCTCGAGATTTCATGTCATCTGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_199129.2-1021s21c1
Sequence:CCGGACCGAAGCCATCTGCCAAATTCTCGAGAATTTGGCAGATGGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_199129.2-864s21c1
Sequence:CCGGTACCCTCTGGAGAAGATAGGCCTCGAGGCCTATCTTCTCCAGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199129
VALIDATED
TMEM189 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 189
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199129.1-859s1c1
Sequence:CCGGCTCGGGCAGATGACATGAAATCTCGAGATTTCATGTCATCTGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199129.1-524s1c1
Sequence:CCGGGCTGCTAAACATGGCCTACAACTCGAGTTGTAGGCCATGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199129.1-309s1c1
Sequence:CCGGCTCGTCATACTCGGTGTTGTTCTCGAGAACAACACCGAGTATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199129.1-766s1c1
Sequence:CCGGGCATCACCACAGGCTGGCTCACTCGAGTGAGCCAGCCTGTGGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199129.1-869s1c1
Sequence:CCGGTGACATGAAATGGGCCCAGAACTCGAGTTCTGGGCCCATTTCATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199129.2-968s21c1
Sequence:CCGGCAAATAACTTCTCCGAGCCTGCTCGAGCAGGCTCGGAGAAGTTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_199129.2-841s21c1
Sequence:CCGGGCATCACCACAGGCTGGCTCACTCGAGTGAGCCAGCCTGTGGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199129.2-934s21c1
Sequence:CCGGCTCGGGCAGATGACATGAAATCTCGAGATTTCATGTCATCTGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_199129.2-1021s21c1
Sequence:CCGGACCGAAGCCATCTGCCAAATTCTCGAGAATTTGGCAGATGGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_199129.2-864s21c1
Sequence:CCGGTACCCTCTGGAGAAGATAGGCCTCGAGGCCTATCTTCTCCAGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145538
VALIDATED
TMEM189 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 189
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-894s1c1
Sequence:CCGGCCAAACCTGAACTGAAGCCATCTCGAGATGGCTTCAGTTCAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-714s1c1
Sequence:CCGGCCACGAAACATACTTCTGTATCTCGAGATACAGAAGTATGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-606s1c1
Sequence:CCGGCCACAAGTGGTCACACACATACTCGAGTATGTGTGTGACCACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-438s1c1
Sequence:CCGGGCATGACTTCATCGAGACCAACTCGAGTTGGTCTCGATGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-834s1c1
Sequence:CCGGCGACATGAAATGGGCACAGAACTCGAGTTCTGTGCCCATTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145538.2-894s21c1
Sequence:CCGGCCAAACCTGAACTGAAGCCATCTCGAGATGGCTTCAGTTCAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-438s21c1
Sequence:CCGGGCATGACTTCATCGAGACCAACTCGAGTTGGTCTCGATGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-714s21c1
Sequence:CCGGCCACGAAACATACTTCTGTATCTCGAGATACAGAAGTATGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-834s21c1
Sequence:CCGGCGACATGAAATGGGCACAGAACTCGAGTTCTGTGCCCATTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-606s21c1
Sequence:CCGGCCACAAGTGGTCACACACATACTCGAGTATGTGTGTGACCACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145538
VALIDATED
TMEM189 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 189
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-894s1c1
Sequence:CCGGCCAAACCTGAACTGAAGCCATCTCGAGATGGCTTCAGTTCAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-714s1c1
Sequence:CCGGCCACGAAACATACTTCTGTATCTCGAGATACAGAAGTATGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-606s1c1
Sequence:CCGGCCACAAGTGGTCACACACATACTCGAGTATGTGTGTGACCACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-438s1c1
Sequence:CCGGGCATGACTTCATCGAGACCAACTCGAGTTGGTCTCGATGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-834s1c1
Sequence:CCGGCGACATGAAATGGGCACAGAACTCGAGTTCTGTGCCCATTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145538.2-894s21c1
Sequence:CCGGCCAAACCTGAACTGAAGCCATCTCGAGATGGCTTCAGTTCAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-438s21c1
Sequence:CCGGGCATGACTTCATCGAGACCAACTCGAGTTGGTCTCGATGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-714s21c1
Sequence:CCGGCCACGAAACATACTTCTGTATCTCGAGATACAGAAGTATGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-834s21c1
Sequence:CCGGCGACATGAAATGGGCACAGAACTCGAGTTCTGTGCCCATTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-606s21c1
Sequence:CCGGCCACAAGTGGTCACACACATACTCGAGTATGTGTGTGACCACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145538
VALIDATED
TMEM189 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 189
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-894s1c1
Sequence:CCGGCCAAACCTGAACTGAAGCCATCTCGAGATGGCTTCAGTTCAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-714s1c1
Sequence:CCGGCCACGAAACATACTTCTGTATCTCGAGATACAGAAGTATGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-606s1c1
Sequence:CCGGCCACAAGTGGTCACACACATACTCGAGTATGTGTGTGACCACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-438s1c1
Sequence:CCGGGCATGACTTCATCGAGACCAACTCGAGTTGGTCTCGATGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145538.1-834s1c1
Sequence:CCGGCGACATGAAATGGGCACAGAACTCGAGTTCTGTGCCCATTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145538.2-894s21c1
Sequence:CCGGCCAAACCTGAACTGAAGCCATCTCGAGATGGCTTCAGTTCAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-438s21c1
Sequence:CCGGGCATGACTTCATCGAGACCAACTCGAGTTGGTCTCGATGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-714s21c1
Sequence:CCGGCCACGAAACATACTTCTGTATCTCGAGATACAGAAGTATGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-834s21c1
Sequence:CCGGCGACATGAAATGGGCACAGAACTCGAGTTCTGTGCCCATTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145538.2-606s21c1
Sequence:CCGGCCACAAGTGGTCACACACATACTCGAGTATGTGTGTGACCACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks