EMAIL THIS PAGE TO A FRIEND

TMEM18

transmembrane protein 18

UniProtKB ID: Q96B42, D6W4X9, Q8N5H2, Q9NTH3
Gene ID:
Mouse(211986) transmembrane protein 18
Rat(362722) transmembrane protein 18
Zebrafish(449559) transmembrane protein 18
chicken(421911) transmembrane protein 18
domestic cat(101092101) transmembrane protein 18
cow(616554) transmembrane protein 18
sheep(101112458) transmembrane protein 18
domestic guinea pig(100728948) transmembrane protein 18
naked mole-rat(101705275) transmembrane protein 18
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152834 Rosetta Predictions human pricing
NM_001007748 Rosetta Predictions rat pricing
NM_172049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097778 predicted 711
2 SASI_Hs01_00097781 predicted 714
3 SASI_Hs01_00097779 predicted 238
4 SASI_Hs02_00366765 predicted 707
5 SASI_Hs01_00097780 predicted 311
6 SASI_Hs01_00097782 predicted 802
7 SASI_Hs02_00366766 predicted 434
8 SASI_Hs01_00097784 predicted 429
9 SASI_Hs01_00097785 predicted 653
10 SASI_Hs01_00097786 predicted 765
11 SASI_Hs01_00097783 predicted 276
12 SASI_Hs01_00097787 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058248 predicted 839
2 SASI_Rn01_00058249 predicted 624
3 SASI_Rn01_00058250 predicted 602
4 SASI_Rn01_00058251 predicted 290
5 SASI_Rn01_00058252 predicted 922
6 SASI_Rn01_00058253 predicted 630
7 SASI_Rn01_00058254 predicted 518
8 SASI_Rn02_00198942 predicted 583
9 SASI_Rn01_00058255 predicted 955
10 SASI_Rn01_00058256 predicted 515
11 SASI_Rn01_00058257 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343637 predicted 769
2 SASI_Mm01_00100559 predicted 927
3 SASI_Mm02_00343638 predicted 747
4 SASI_Mm02_00343639 predicted 840
5 SASI_Mm01_00100561 predicted 963
6 SASI_Mm02_00343640 predicted 839
7 SASI_Mm02_00343641 predicted 729
8 SASI_Mm02_00343642 predicted 733
9 SASI_Mm01_00100558 predicted 784
10 SASI_Mm02_00343643 predicted 207
11 SASI_Mm01_00100560 predicted 627
12 SASI_Mm01_00100562 predicted 589
13 SASI_Mm01_00100563 predicted 361
14 SASI_Mm01_00100564 predicted 618
15 SASI_Mm01_00100565 predicted 480
16 SASI_Mm01_00100566 predicted 653
17 SASI_Mm01_00100567 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172049
VALIDATED
TMEM18 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 18
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-263s1c1
Sequence:CCGGCTGGAGATTGTTCTCAAAGTACTCGAGTACTTTGAGAACAATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-1622s1c1
Sequence:CCGGCGTTTGATAGACTACCGTTATCTCGAGATAACGGTAGTCTATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-354s1c1
Sequence:CCGGCTCATTGTGATTATGTGGGTACTCGAGTACCCACATAATCACAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-266s1c1
Sequence:CCGGGAGATTGTTCTCAAAGTACCACTCGAGTGGTACTTTGAGAACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172049
VALIDATED
TMEM18 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 18
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-263s1c1
Sequence:CCGGCTGGAGATTGTTCTCAAAGTACTCGAGTACTTTGAGAACAATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-1622s1c1
Sequence:CCGGCGTTTGATAGACTACCGTTATCTCGAGATAACGGTAGTCTATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-354s1c1
Sequence:CCGGCTCATTGTGATTATGTGGGTACTCGAGTACCCACATAATCACAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-266s1c1
Sequence:CCGGGAGATTGTTCTCAAAGTACCACTCGAGTGGTACTTTGAGAACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172049
VALIDATED
TMEM18 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 18
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-263s1c1
Sequence:CCGGCTGGAGATTGTTCTCAAAGTACTCGAGTACTTTGAGAACAATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-1622s1c1
Sequence:CCGGCGTTTGATAGACTACCGTTATCTCGAGATAACGGTAGTCTATCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-354s1c1
Sequence:CCGGCTCATTGTGATTATGTGGGTACTCGAGTACCCACATAATCACAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172049.1-266s1c1
Sequence:CCGGGAGATTGTTCTCAAAGTACCACTCGAGTGGTACTTTGAGAACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152834
VALIDATED
TMEM18 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 18
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152834.2-293s1c1
Sequence:CCGGGAATACATCAATGAGGCGGCTCTCGAGAGCCGCCTCATTGATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152834.2-1837s1c1
Sequence:CCGGCCACCCAAATTGCATCTCAAACTCGAGTTTGAGATGCAATTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152834.2-269s1c1
Sequence:CCGGCTAGTCATCTTAGTCTACTGTCTCGAGACAGTAGACTAAGATGACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152834.2-277s1c1
Sequence:CCGGCTTAGTCTACTGTGCTGAATACTCGAGTATTCAGCACAGTAGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152834.2-445s1c1
Sequence:CCGGGAATGTGATGACTGACCTGAACTCGAGTTCAGGTCAGTCATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152834.2-311s1c1
Sequence:CCGGGCTGCGATGAACTGGAGATTACTCGAGTAATCTCCAGTTCATCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152834.2-1211s1c1
Sequence:CCGGGCAAAGTTATGGGCTGCTTTACTCGAGTAAAGCAGCCCATAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152834.2-661s1c1
Sequence:CCGGGCACACACTGAAGTTGGCTTTCTCGAGAAAGCCAACTTCAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-766s21c1
Sequence:CCGGGAGCTTCATAACTGGGAATTTCTCGAGAAATTCCCAGTTATGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-278s21c1
Sequence:CCGGTTAGTCTACTGTGCTGAATACCTCGAGGTATTCAGCACAGTAGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-790s21c1
Sequence:CCGGTTGAAGAAGTCCATGTCATATCTCGAGATATGACATGGACTTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152834.2-242s21c1
Sequence:CCGGAGACTACAGATCGGGCACTTTCTCGAGAAAGTGCCCGATCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-399s21c1
Sequence:CCGGTGGTGAATGCCATGATCATTGCTCGAGCAATGATCATGGCATTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-313s21c1
Sequence:CCGGTGCGATGAACTGGAGATTATTCTCGAGAATAATCTCCAGTTCATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152834.2-363s21c1
Sequence:CCGGGGATGTTCATTTCTATAGTATCTCGAGATACTATAGAAATGAACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152834
VALIDATED
TMEM18 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 18
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152834.2-293s1c1
Sequence:CCGGGAATACATCAATGAGGCGGCTCTCGAGAGCCGCCTCATTGATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152834.2-1837s1c1
Sequence:CCGGCCACCCAAATTGCATCTCAAACTCGAGTTTGAGATGCAATTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152834.2-269s1c1
Sequence:CCGGCTAGTCATCTTAGTCTACTGTCTCGAGACAGTAGACTAAGATGACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152834.2-277s1c1
Sequence:CCGGCTTAGTCTACTGTGCTGAATACTCGAGTATTCAGCACAGTAGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152834.2-445s1c1
Sequence:CCGGGAATGTGATGACTGACCTGAACTCGAGTTCAGGTCAGTCATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152834.2-311s1c1
Sequence:CCGGGCTGCGATGAACTGGAGATTACTCGAGTAATCTCCAGTTCATCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152834.2-1211s1c1
Sequence:CCGGGCAAAGTTATGGGCTGCTTTACTCGAGTAAAGCAGCCCATAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152834.2-661s1c1
Sequence:CCGGGCACACACTGAAGTTGGCTTTCTCGAGAAAGCCAACTTCAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-766s21c1
Sequence:CCGGGAGCTTCATAACTGGGAATTTCTCGAGAAATTCCCAGTTATGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-278s21c1
Sequence:CCGGTTAGTCTACTGTGCTGAATACCTCGAGGTATTCAGCACAGTAGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-790s21c1
Sequence:CCGGTTGAAGAAGTCCATGTCATATCTCGAGATATGACATGGACTTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152834.2-242s21c1
Sequence:CCGGAGACTACAGATCGGGCACTTTCTCGAGAAAGTGCCCGATCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-399s21c1
Sequence:CCGGTGGTGAATGCCATGATCATTGCTCGAGCAATGATCATGGCATTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-313s21c1
Sequence:CCGGTGCGATGAACTGGAGATTATTCTCGAGAATAATCTCCAGTTCATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152834.2-363s21c1
Sequence:CCGGGGATGTTCATTTCTATAGTATCTCGAGATACTATAGAAATGAACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152834
VALIDATED
TMEM18 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 18
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152834.2-293s1c1
Sequence:CCGGGAATACATCAATGAGGCGGCTCTCGAGAGCCGCCTCATTGATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152834.2-1837s1c1
Sequence:CCGGCCACCCAAATTGCATCTCAAACTCGAGTTTGAGATGCAATTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152834.2-269s1c1
Sequence:CCGGCTAGTCATCTTAGTCTACTGTCTCGAGACAGTAGACTAAGATGACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152834.2-277s1c1
Sequence:CCGGCTTAGTCTACTGTGCTGAATACTCGAGTATTCAGCACAGTAGACTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152834.2-445s1c1
Sequence:CCGGGAATGTGATGACTGACCTGAACTCGAGTTCAGGTCAGTCATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152834.2-311s1c1
Sequence:CCGGGCTGCGATGAACTGGAGATTACTCGAGTAATCTCCAGTTCATCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152834.2-1211s1c1
Sequence:CCGGGCAAAGTTATGGGCTGCTTTACTCGAGTAAAGCAGCCCATAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152834.2-661s1c1
Sequence:CCGGGCACACACTGAAGTTGGCTTTCTCGAGAAAGCCAACTTCAGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-766s21c1
Sequence:CCGGGAGCTTCATAACTGGGAATTTCTCGAGAAATTCCCAGTTATGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-278s21c1
Sequence:CCGGTTAGTCTACTGTGCTGAATACCTCGAGGTATTCAGCACAGTAGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-790s21c1
Sequence:CCGGTTGAAGAAGTCCATGTCATATCTCGAGATATGACATGGACTTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152834.2-242s21c1
Sequence:CCGGAGACTACAGATCGGGCACTTTCTCGAGAAAGTGCCCGATCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-399s21c1
Sequence:CCGGTGGTGAATGCCATGATCATTGCTCGAGCAATGATCATGGCATTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152834.2-313s21c1
Sequence:CCGGTGCGATGAACTGGAGATTATTCTCGAGAATAATCTCCAGTTCATCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152834.2-363s21c1
Sequence:CCGGGGATGTTCATTTCTATAGTATCTCGAGATACTATAGAAATGAACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks