EMAIL THIS PAGE TO A FRIEND

TMEM190

transmembrane protein 190

Synonyms: MDAC1
UniProtKB ID: Q8WZ59, A6NJL5
Gene ID:
Mouse(78052) transmembrane protein 190
Rat(691446) transmembrane protein 190
cow(504932) transmembrane protein 190
sheep(101120518) transmembrane protein 190
domestic guinea pig(100735262) transmembrane protein 190
dog(476379) transmembrane protein 190
domestic cat(101084841) transmembrane protein 190
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139172 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056181 MISSION® esiRNA esiRNA human TMEM190 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139172 Rosetta Predictions human pricing
XM_001078306 Rosetta Predictions rat pricing
XM_911732 Rosetta Predictions mouse pricing
XM_973679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069142 predicted 214
2 SASI_Hs01_00069143 predicted 239
3 SASI_Hs01_00069144 predicted 177
4 SASI_Hs01_00069145 predicted 180
5 SASI_Hs01_00069146 predicted 328
6 SASI_Hs01_00069147 predicted 59
7 SASI_Hs01_00069149 predicted 84
8 SASI_Hs01_00069150 predicted 90
9 SASI_Hs01_00069151 predicted 53
10 SASI_Hs02_00364203 predicted 181
11 SASI_Hs01_00069148 predicted 107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360290 predicted 203
2 SASI_Rn02_00360291 predicted 200
3 SASI_Rn02_00360292 predicted 218
4 SASI_Rn02_00360293 predicted 329
5 SASI_Rn02_00360294 predicted 276
6 SASI_Rn02_00360295 predicted 287
7 SASI_Rn02_00360296 predicted 201
8 SASI_Rn02_00360297 predicted 277
9 SASI_Rn02_00360298 predicted 327
10 SASI_Rn02_00360299 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436598 predicted 217
2 SASI_Mm02_00436599 predicted 216
3 SASI_Mm02_00436600 predicted 218
4 SASI_Mm02_00436601 predicted 289
5 SASI_Mm02_00436602 predicted 292
6 SASI_Mm02_00436603 predicted 284
7 SASI_Mm02_00436604 predicted 342
8 SASI_Mm02_00436605 predicted 299
9 SASI_Mm02_00436606 predicted 204
10 SASI_Mm02_00436607 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214666 predicted 222
2 SASI_Mm01_00214667 predicted 218
3 SASI_Mm01_00214668 predicted 222
4 SASI_Mm01_00214669 predicted 288
5 SASI_Mm01_00214670 predicted 290
6 SASI_Mm01_00214671 predicted 283
7 SASI_Mm01_00214672 predicted 299
8 SASI_Mm01_00214674 predicted 251
9 SASI_Mm01_00214675 predicted 297
10 SASI_Mm02_00445094 predicted 204
11 SASI_Mm01_00214673 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030028
TMEM190 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 190
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-175s21c1
Sequence:CCGGGGGTCAGGCAGCAATTGAGAACTCGAGTTCTCAATTGCTGCCTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-381s21c1
Sequence:CCGGCAAGGTTTCTACATCGGAAATCTCGAGATTTCCGATGTAGAAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-232s21c1
Sequence:CCGGGGACGGTGTGTGCTATCATCACTCGAGTGATGATAGCACACACCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-317s21c1
Sequence:CCGGCTCTTCCTGATCACCAGTATCCTCGAGGATACTGGTGATCAGGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-104s21c1
Sequence:CCGGGCGAATGGAATCCAGGGATTTCTCGAGAAATCCCTGGATTCCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030028
TMEM190 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 190
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-175s21c1
Sequence:CCGGGGGTCAGGCAGCAATTGAGAACTCGAGTTCTCAATTGCTGCCTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-381s21c1
Sequence:CCGGCAAGGTTTCTACATCGGAAATCTCGAGATTTCCGATGTAGAAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-232s21c1
Sequence:CCGGGGACGGTGTGTGCTATCATCACTCGAGTGATGATAGCACACACCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-317s21c1
Sequence:CCGGCTCTTCCTGATCACCAGTATCCTCGAGGATACTGGTGATCAGGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-104s21c1
Sequence:CCGGGCGAATGGAATCCAGGGATTTCTCGAGAAATCCCTGGATTCCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030028
TMEM190 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 190
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-175s21c1
Sequence:CCGGGGGTCAGGCAGCAATTGAGAACTCGAGTTCTCAATTGCTGCCTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-381s21c1
Sequence:CCGGCAAGGTTTCTACATCGGAAATCTCGAGATTTCCGATGTAGAAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-232s21c1
Sequence:CCGGGGACGGTGTGTGCTATCATCACTCGAGTGATGATAGCACACACCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-317s21c1
Sequence:CCGGCTCTTCCTGATCACCAGTATCCTCGAGGATACTGGTGATCAGGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030028.1-104s21c1
Sequence:CCGGGCGAATGGAATCCAGGGATTTCTCGAGAAATCCCTGGATTCCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139172
TMEM190 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 190
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-77s21c1
Sequence:CCGGACGGAAATGGAATCCAGGGATCTCGAGATCCCTGGATTCCATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-302s21c1
Sequence:CCGGGCTGCAGCATCTGCTTGTTCTCTCGAGAGAACAAGCAGATGCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-371s21c1
Sequence:CCGGGTCCGTGTGACATGTCCAAGTCTCGAGACTTGGACATGTCACACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-221s21c1
Sequence:CCGGACCACCAGCGTCCAGACGAAACTCGAGTTTCGTCTGGACGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-110s21c1
Sequence:CCGGGGAGCTGTGAGGGTGACATATCTCGAGATATGTCACCCTCACAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139172
TMEM190 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 190
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-77s21c1
Sequence:CCGGACGGAAATGGAATCCAGGGATCTCGAGATCCCTGGATTCCATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-302s21c1
Sequence:CCGGGCTGCAGCATCTGCTTGTTCTCTCGAGAGAACAAGCAGATGCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-371s21c1
Sequence:CCGGGTCCGTGTGACATGTCCAAGTCTCGAGACTTGGACATGTCACACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-221s21c1
Sequence:CCGGACCACCAGCGTCCAGACGAAACTCGAGTTTCGTCTGGACGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-110s21c1
Sequence:CCGGGGAGCTGTGAGGGTGACATATCTCGAGATATGTCACCCTCACAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139172
TMEM190 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 190
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-77s21c1
Sequence:CCGGACGGAAATGGAATCCAGGGATCTCGAGATCCCTGGATTCCATTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-302s21c1
Sequence:CCGGGCTGCAGCATCTGCTTGTTCTCTCGAGAGAACAAGCAGATGCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-371s21c1
Sequence:CCGGGTCCGTGTGACATGTCCAAGTCTCGAGACTTGGACATGTCACACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-221s21c1
Sequence:CCGGACCACCAGCGTCCAGACGAAACTCGAGTTTCGTCTGGACGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139172.1-110s21c1
Sequence:CCGGGGAGCTGTGAGGGTGACATATCTCGAGATATGTCACCCTCACAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks