EMAIL THIS PAGE TO A FRIEND

TMEM191A

transmembrane protein 191A (pseudogene)

Synonyms: TMEM191AP
Species: Human TMEM191A(84222)
UniProtKB ID: Q9H0A3, B2R8E2
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032262 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032262 Rosetta Predictions human pricing
XR_039956 Rosetta Predictions human pricing
XR_039957 Rosetta Predictions human pricing
XR_039958 Rosetta Predictions human pricing
XR_039959 Rosetta Predictions human pricing
XR_039960 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123299 predicted 390
2 SASI_Hs01_00123300 predicted 399
3 SASI_Hs01_00123301 predicted 454
4 SASI_Hs01_00123302 predicted 508
5 SASI_Hs01_00123303 predicted 370
6 SASI_Hs01_00123304 predicted 381
7 SASI_Hs01_00123305 predicted 763
8 SASI_Hs01_00123306 predicted 766
9 SASI_Hs01_00123307 predicted 431
10 SASI_Hs01_00123308 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514613 predicted 564
2 SASI_Hs02_00514614 predicted 570
3 SASI_Hs02_00514615 predicted 625
4 SASI_Hs02_00514616 predicted 682
5 SASI_Hs02_00514617 predicted 544
6 SASI_Hs02_00514618 predicted 607
7 SASI_Hs02_00514619 predicted 683
8 SASI_Hs02_00514620 predicted 626
9 SASI_Hs02_00514621 predicted 566
10 SASI_Hs02_00514622 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514623 predicted 1915
2 SASI_Hs02_00514624 predicted 1916
3 SASI_Hs02_00514625 predicted 1706
4 SASI_Hs02_00514626 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514627 predicted 1539
2 SASI_Hs02_00514628 predicted 1541
3 SASI_Hs02_00514629 predicted 2268
4 SASI_Hs02_00514630 predicted 1981
5 SASI_Hs02_00514631 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514632 predicted 1537
2 SASI_Hs02_00514633 predicted 1540
3 SASI_Hs02_00514634 predicted 2263
4 SASI_Hs02_00514635 predicted 1981
5 SASI_Hs02_00514636 predicted 1953
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514637 predicted 1921
2 SASI_Hs02_00514638 predicted 1917
3 SASI_Hs02_00514639 predicted 1709
4 SASI_Hs02_00514640 predicted 1669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032262
TMEM191A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 191A (pseudogene)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-288s1c1
Sequence:CCGGCTGCAGCTAGCTTCGATTGTTCTCGAGAACAATCGAAGCTAGCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-378s1c1
Sequence:CCGGCCTACAGTCTCACCAAGCAATCTCGAGATTGCTTGGTGAGACTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-510s1c1
Sequence:CCGGGCTCTAGGCATACCACATAATCTCGAGATTATGTGGTATGCCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-134s1c1
Sequence:CCGGCATGGATTTCTGTTTCCCTTTCTCGAGAAAGGGAAACAGAAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-495s1c1
Sequence:CCGGCTAGACATCATAATAGCTCTACTCGAGTAGAGCTATTATGATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032262.1-680s1c1
Sequence:CCGGCGAACATATTTATGGGTTCTTCTCGAGAAGAACCCATAAATATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-186s1c1
Sequence:CCGGGCATCCAAGTTCATAATTGTACTCGAGTACAATTATGAACTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032262.1-703s1c1
Sequence:CCGGCCACAAGAGATCGATCAGTTTCTCGAGAAACTGATCGATCTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-414s1c1
Sequence:CCGGCTTCCTGTTTCCTTTACGGATCTCGAGATCCGTAAAGGAAACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-522s1c1
Sequence:CCGGCCACATAATACCCAAGCACATCTCGAGATGTGCTTGGGTATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032262
TMEM191A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 191A (pseudogene)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-288s1c1
Sequence:CCGGCTGCAGCTAGCTTCGATTGTTCTCGAGAACAATCGAAGCTAGCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-378s1c1
Sequence:CCGGCCTACAGTCTCACCAAGCAATCTCGAGATTGCTTGGTGAGACTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-510s1c1
Sequence:CCGGGCTCTAGGCATACCACATAATCTCGAGATTATGTGGTATGCCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-134s1c1
Sequence:CCGGCATGGATTTCTGTTTCCCTTTCTCGAGAAAGGGAAACAGAAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-495s1c1
Sequence:CCGGCTAGACATCATAATAGCTCTACTCGAGTAGAGCTATTATGATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032262.1-680s1c1
Sequence:CCGGCGAACATATTTATGGGTTCTTCTCGAGAAGAACCCATAAATATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-186s1c1
Sequence:CCGGGCATCCAAGTTCATAATTGTACTCGAGTACAATTATGAACTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032262.1-703s1c1
Sequence:CCGGCCACAAGAGATCGATCAGTTTCTCGAGAAACTGATCGATCTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-414s1c1
Sequence:CCGGCTTCCTGTTTCCTTTACGGATCTCGAGATCCGTAAAGGAAACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-522s1c1
Sequence:CCGGCCACATAATACCCAAGCACATCTCGAGATGTGCTTGGGTATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032262
TMEM191A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 191A (pseudogene)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-288s1c1
Sequence:CCGGCTGCAGCTAGCTTCGATTGTTCTCGAGAACAATCGAAGCTAGCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-378s1c1
Sequence:CCGGCCTACAGTCTCACCAAGCAATCTCGAGATTGCTTGGTGAGACTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-510s1c1
Sequence:CCGGGCTCTAGGCATACCACATAATCTCGAGATTATGTGGTATGCCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-134s1c1
Sequence:CCGGCATGGATTTCTGTTTCCCTTTCTCGAGAAAGGGAAACAGAAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-495s1c1
Sequence:CCGGCTAGACATCATAATAGCTCTACTCGAGTAGAGCTATTATGATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032262.1-680s1c1
Sequence:CCGGCGAACATATTTATGGGTTCTTCTCGAGAAGAACCCATAAATATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-186s1c1
Sequence:CCGGGCATCCAAGTTCATAATTGTACTCGAGTACAATTATGAACTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032262.1-703s1c1
Sequence:CCGGCCACAAGAGATCGATCAGTTTCTCGAGAAACTGATCGATCTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-414s1c1
Sequence:CCGGCTTCCTGTTTCCTTTACGGATCTCGAGATCCGTAAAGGAAACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032262.1-522s1c1
Sequence:CCGGCCACATAATACCCAAGCACATCTCGAGATGTGCTTGGGTATTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks