EMAIL THIS PAGE TO A FRIEND

TMEM191C

transmembrane protein 191C

UniProtKB ID: A6NGB0
Gene ID:
Mouse(224019) transmembrane protein 191C
Rat(680867) transmembrane protein 191C
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_358773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080001 MISSION® esiRNA esiRNA targeting mouse Tmem191c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725851 Rosetta Predictions human pricing
XM_928466 Rosetta Predictions human pricing
XM_001059247 Rosetta Predictions rat pricing
XM_358773 Rosetta Predictions mouse pricing
XM_910361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470407 predicted 1514
2 SASI_Hs02_00470408 predicted 1351
3 SASI_Hs02_00470409 predicted 1527
4 SASI_Hs02_00470410 predicted 1444
5 SASI_Hs02_00470411 predicted 1515
6 SASI_Hs02_00470412 predicted 917
7 SASI_Hs02_00470413 predicted 1581
8 SASI_Hs02_00470414 predicted 1497
9 SASI_Hs02_00470415 predicted 1394
10 SASI_Hs02_00470416 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281727 predicted 2407
2 SASI_Hs01_00281728 predicted 2251
3 SASI_Hs01_00281729 predicted 2418
4 SASI_Hs01_00281730 predicted 2332
5 SASI_Hs01_00281731 predicted 2409
6 SASI_Hs01_00281732 predicted 2415
7 SASI_Hs01_00281725 predicted 1809
8 SASI_Hs02_00480862 predicted 2478
9 SASI_Hs02_00480863 predicted 2296
10 SASI_Hs02_00480864 predicted 2259
11 SASI_Hs01_00281724 predicted 755
12 SASI_Hs01_00281726 predicted 1105
13 SASI_Hs01_00281733 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292608 predicted 210
2 SASI_Rn02_00292609 predicted 204
3 SASI_Rn02_00292610 predicted 151
4 SASI_Rn02_00292611 predicted 327
5 SASI_Rn02_00292612 predicted 168
6 SASI_Rn02_00292613 predicted 275
7 SASI_Rn02_00292614 predicted 148
8 SASI_Rn02_00292615 predicted 376
9 SASI_Rn02_00292616 predicted 110
10 SASI_Rn02_00292617 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426261 predicted 1014
2 SASI_Mm02_00426262 predicted 1104
3 SASI_Mm01_00211984 predicted 620
4 SASI_Mm01_00211985 predicted 619
5 SASI_Mm02_00426263 predicted 772
6 SASI_Mm01_00211986 predicted 917
7 SASI_Mm01_00211989 predicted 631
8 SASI_Mm01_00211990 predicted 658
9 SASI_Mm01_00211991 predicted 866
10 SASI_Mm01_00211992 predicted 983
11 SASI_Mm01_00211987 predicted 318
12 SASI_Mm01_00211988 predicted 350
13 SASI_Mm01_00211993 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435477 predicted 1021
2 SASI_Mm02_00435478 predicted 1096
3 SASI_Mm02_00435479 predicted 616
4 SASI_Mm02_00435480 predicted 621
5 SASI_Mm02_00435481 predicted 769
6 SASI_Mm02_00435482 predicted 912
7 SASI_Mm02_00435483 predicted 631
8 SASI_Mm02_00435484 predicted 655
9 SASI_Mm02_00435485 predicted 867
10 SASI_Mm02_00435486 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358773
TMEM191C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 191C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_358773.6-528s1c1
Sequence:CCGGCCTGGTGCTGCCGCTGATTTACTCGAGTAAATCAGCGGCAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_358773.6-544s1c1
Sequence:CCGGATTTACGTGGTGCTGGCGAAGCTCGAGCTTCGCCAGCACCACGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_358773.6-625s1c1
Sequence:CCGGCGCTACACGCTGTCGCCTTTACTCGAGTAAAGGCGACAGCGTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_358773.6-917s1c1
Sequence:CCGGCTCCGTAGTGGGTGGATTATTCTCGAGAATAATCCACCCACTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219499    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_358773.6-681s1c1
Sequence:CCGGGAGTGCATCATGTCGGCTTTGCTCGAGCAAAGCCGACATGATGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358773
TMEM191C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 191C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_358773.6-528s1c1
Sequence:CCGGCCTGGTGCTGCCGCTGATTTACTCGAGTAAATCAGCGGCAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_358773.6-544s1c1
Sequence:CCGGATTTACGTGGTGCTGGCGAAGCTCGAGCTTCGCCAGCACCACGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_358773.6-625s1c1
Sequence:CCGGCGCTACACGCTGTCGCCTTTACTCGAGTAAAGGCGACAGCGTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_358773.6-917s1c1
Sequence:CCGGCTCCGTAGTGGGTGGATTATTCTCGAGAATAATCCACCCACTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219499    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_358773.6-681s1c1
Sequence:CCGGGAGTGCATCATGTCGGCTTTGCTCGAGCAAAGCCGACATGATGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358773
TMEM191C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 191C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_358773.6-528s1c1
Sequence:CCGGCCTGGTGCTGCCGCTGATTTACTCGAGTAAATCAGCGGCAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_358773.6-544s1c1
Sequence:CCGGATTTACGTGGTGCTGGCGAAGCTCGAGCTTCGCCAGCACCACGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_358773.6-625s1c1
Sequence:CCGGCGCTACACGCTGTCGCCTTTACTCGAGTAAAGGCGACAGCGTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_358773.6-917s1c1
Sequence:CCGGCTCCGTAGTGGGTGGATTATTCTCGAGAATAATCCACCCACTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219499    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_358773.6-681s1c1
Sequence:CCGGGAGTGCATCATGTCGGCTTTGCTCGAGCAAAGCCGACATGATGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks