EMAIL THIS PAGE TO A FRIEND

TMEM192

transmembrane protein 192

UniProtKB ID: Q8IY95, Q7Z3A1, Q8N928
Gene ID:
Mouse(73067) transmembrane protein 192
Rat(361137) transmembrane protein 192
cow(613396) transmembrane protein 192
domestic guinea pig(100721948) transmembrane protein 192
naked mole-rat(101720990) transmembrane protein 192
Zebrafish(797335) transmembrane protein 192
domestic cat(101081976) transmembrane protein 192
dog(475489) transmembrane protein 192-like
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100389 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152681 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007801 MISSION® esiRNA esiRNA targeting mouse Tmem192 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100389 Rosetta Predictions human pricing
NM_152681 Rosetta Predictions human pricing
NM_001014141 Rosetta Predictions rat pricing
NM_028427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321854 predicted 437
2 SASI_Hs02_00321855 predicted 770
3 SASI_Hs02_00321856 predicted 784
4 SASI_Hs02_00321857 predicted 502
5 SASI_Hs02_00321858 predicted 647
6 SASI_Hs02_00321859 predicted 364
7 SASI_Hs02_00321860 predicted 812
8 SASI_Hs02_00321861 predicted 313
9 SASI_Hs02_00321862 predicted 484
10 SASI_Hs02_00321863 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168272 predicted 863
2 SASI_Hs01_00168273 predicted 269
3 SASI_Hs01_00168274 predicted 704
4 SASI_Hs01_00168275 predicted 440
5 SASI_Hs01_00168276 predicted 751
6 SASI_Hs01_00168277 predicted 204
7 SASI_Hs01_00168278 predicted 566
8 SASI_Hs01_00168279 predicted 722
9 SASI_Hs01_00168280 predicted 908
10 SASI_Hs01_00168281 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089742 predicted 244
2 SASI_Rn01_00089743 predicted 748
3 SASI_Rn01_00089744 predicted 422
4 SASI_Rn01_00089745 predicted 344
5 SASI_Rn01_00089747 predicted 553
6 SASI_Rn02_00201601 predicted 348
7 SASI_Rn01_00089749 predicted 379
8 SASI_Rn02_00201602 predicted 246
9 SASI_Rn01_00089750 predicted 515
10 SASI_Rn01_00089751 predicted 363
11 SASI_Rn01_00089746 predicted 269
12 SASI_Rn01_00089748 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046184 predicted 213
2 SASI_Mm01_00046185 predicted 480
3 SASI_Mm01_00046186 predicted 652
4 SASI_Mm01_00046188 predicted 667
5 SASI_Mm01_00046189 predicted 602
6 SASI_Mm02_00333857 predicted 665
7 SASI_Mm01_00046190 predicted 457
8 SASI_Mm01_00046191 predicted 406
9 SASI_Mm01_00046192 predicted 215
10 SASI_Mm01_00046193 predicted 281
11 SASI_Mm01_00046187 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100389
VALIDATED
TMEM192 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 192
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100389.1-1105s21c1
Sequence:CCGGTACCTGTAGAAGCCCGGATAACTCGAGTTATCCGGGCTTCTACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100389.1-849s21c1
Sequence:CCGGGCTGCTGAGTAAGCGATTGTTCTCGAGAACAATCGCTTACTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100389.1-427s21c1
Sequence:CCGGCTTGAATGCTACATCCAGTATCTCGAGATACTGGATGTAGCATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100389.1-368s21c1
Sequence:CCGGTGAAAGTTCAGACGGTTATAACTCGAGTTATAACCGTCTGAACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100389.1-647s21c1
Sequence:CCGGCCCTGATATGTCTCCTCATTTCTCGAGAAATGAGGAGACATATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100389
VALIDATED
TMEM192 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 192
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100389.1-1105s21c1
Sequence:CCGGTACCTGTAGAAGCCCGGATAACTCGAGTTATCCGGGCTTCTACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100389.1-849s21c1
Sequence:CCGGGCTGCTGAGTAAGCGATTGTTCTCGAGAACAATCGCTTACTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100389.1-427s21c1
Sequence:CCGGCTTGAATGCTACATCCAGTATCTCGAGATACTGGATGTAGCATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100389.1-368s21c1
Sequence:CCGGTGAAAGTTCAGACGGTTATAACTCGAGTTATAACCGTCTGAACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100389.1-647s21c1
Sequence:CCGGCCCTGATATGTCTCCTCATTTCTCGAGAAATGAGGAGACATATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100389
VALIDATED
TMEM192 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 192
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100389.1-1105s21c1
Sequence:CCGGTACCTGTAGAAGCCCGGATAACTCGAGTTATCCGGGCTTCTACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100389.1-849s21c1
Sequence:CCGGGCTGCTGAGTAAGCGATTGTTCTCGAGAACAATCGCTTACTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100389.1-427s21c1
Sequence:CCGGCTTGAATGCTACATCCAGTATCTCGAGATACTGGATGTAGCATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100389.1-368s21c1
Sequence:CCGGTGAAAGTTCAGACGGTTATAACTCGAGTTATAACCGTCTGAACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001100389.1-647s21c1
Sequence:CCGGCCCTGATATGTCTCCTCATTTCTCGAGAAATGAGGAGACATATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028427
VALIDATED
TMEM192 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 192
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028427.2-318s21c1
Sequence:CCGGTTAACGGGTGTGCCGTGTTTGCTCGAGCAAACACGGCACACCCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.2-270s1c1
Sequence:CCGGGCGAACCTTCTGTTGCTTATACTCGAGTATAAGCAACAGAAGGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028427.2-448s21c1
Sequence:CCGGTTGAACGCTACGTCCAGTATCCTCGAGGATACTGGACGTAGCGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028427.2-389s21c1
Sequence:CCGGGAAGGTTCAGACGGCCATAATCTCGAGATTATGGCCGTCTGAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028427.2-270s21c1
Sequence:CCGGGCGAACCTTCTGTTGCTTATACTCGAGTATAAGCAACAGAAGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028427.2-149s21c1
Sequence:CCGGTTCCTTGGATATCCTACAAAGCTCGAGCTTTGTAGGATATCCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.1-329s1c1
Sequence:CCGGGTGCCGTGTTTGTATCCTAATCTCGAGATTAGGATACAAACACGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.1-163s1c1
Sequence:CCGGCCTACAAAGTATGGATGACGACTCGAGTCGTCATCCATACTTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.1-158s1c1
Sequence:CCGGGATATCCTACAAAGTATGGATCTCGAGATCCATACTTTGTAGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028427
VALIDATED
TMEM192 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 192
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028427.2-318s21c1
Sequence:CCGGTTAACGGGTGTGCCGTGTTTGCTCGAGCAAACACGGCACACCCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.2-270s1c1
Sequence:CCGGGCGAACCTTCTGTTGCTTATACTCGAGTATAAGCAACAGAAGGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028427.2-448s21c1
Sequence:CCGGTTGAACGCTACGTCCAGTATCCTCGAGGATACTGGACGTAGCGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028427.2-389s21c1
Sequence:CCGGGAAGGTTCAGACGGCCATAATCTCGAGATTATGGCCGTCTGAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028427.2-270s21c1
Sequence:CCGGGCGAACCTTCTGTTGCTTATACTCGAGTATAAGCAACAGAAGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028427.2-149s21c1
Sequence:CCGGTTCCTTGGATATCCTACAAAGCTCGAGCTTTGTAGGATATCCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.1-329s1c1
Sequence:CCGGGTGCCGTGTTTGTATCCTAATCTCGAGATTAGGATACAAACACGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.1-163s1c1
Sequence:CCGGCCTACAAAGTATGGATGACGACTCGAGTCGTCATCCATACTTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.1-158s1c1
Sequence:CCGGGATATCCTACAAAGTATGGATCTCGAGATCCATACTTTGTAGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028427
VALIDATED
TMEM192 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 192
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028427.2-318s21c1
Sequence:CCGGTTAACGGGTGTGCCGTGTTTGCTCGAGCAAACACGGCACACCCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.2-270s1c1
Sequence:CCGGGCGAACCTTCTGTTGCTTATACTCGAGTATAAGCAACAGAAGGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028427.2-448s21c1
Sequence:CCGGTTGAACGCTACGTCCAGTATCCTCGAGGATACTGGACGTAGCGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028427.2-389s21c1
Sequence:CCGGGAAGGTTCAGACGGCCATAATCTCGAGATTATGGCCGTCTGAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028427.2-270s21c1
Sequence:CCGGGCGAACCTTCTGTTGCTTATACTCGAGTATAAGCAACAGAAGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028427.2-149s21c1
Sequence:CCGGTTCCTTGGATATCCTACAAAGCTCGAGCTTTGTAGGATATCCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.1-329s1c1
Sequence:CCGGGTGCCGTGTTTGTATCCTAATCTCGAGATTAGGATACAAACACGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.1-163s1c1
Sequence:CCGGCCTACAAAGTATGGATGACGACTCGAGTCGTCATCCATACTTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028427.1-158s1c1
Sequence:CCGGGATATCCTACAAAGTATGGATCTCGAGATCCATACTTTGTAGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152681
VALIDATED
TMEM192 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 192
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-499s1c1
Sequence:CCGGCTTGAATGCTACATCCAGTATCTCGAGATACTGGATGTAGCATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-589s1c1
Sequence:CCGGGCGTTGATGATACAGTCCTCTCTCGAGAGAGGACTGTATCATCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-921s1c1
Sequence:CCGGGCTGCTGAGTAAGCGATTGTTCTCGAGAACAATCGCTTACTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152681.1-706s1c1
Sequence:CCGGGAACTCATCTGTTCCCTGATACTCGAGTATCAGGGAACAGATGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152681.1-2028s1c1
Sequence:CCGGGCTGTATATTTCAGTCTGGTTCTCGAGAACCAGACTGAAATATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-719s1c1
Sequence:CCGGCCCTGATATGTCTCCTCATTTCTCGAGAAATGAGGAGACATATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152681.1-437s1c1
Sequence:CCGGCATTGAAAGTTCAGACGGTTACTCGAGTAACCGTCTGAACTTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152681
VALIDATED
TMEM192 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 192
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-499s1c1
Sequence:CCGGCTTGAATGCTACATCCAGTATCTCGAGATACTGGATGTAGCATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-589s1c1
Sequence:CCGGGCGTTGATGATACAGTCCTCTCTCGAGAGAGGACTGTATCATCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-921s1c1
Sequence:CCGGGCTGCTGAGTAAGCGATTGTTCTCGAGAACAATCGCTTACTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152681.1-706s1c1
Sequence:CCGGGAACTCATCTGTTCCCTGATACTCGAGTATCAGGGAACAGATGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152681.1-2028s1c1
Sequence:CCGGGCTGTATATTTCAGTCTGGTTCTCGAGAACCAGACTGAAATATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-719s1c1
Sequence:CCGGCCCTGATATGTCTCCTCATTTCTCGAGAAATGAGGAGACATATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152681.1-437s1c1
Sequence:CCGGCATTGAAAGTTCAGACGGTTACTCGAGTAACCGTCTGAACTTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152681
VALIDATED
TMEM192 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 192
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-499s1c1
Sequence:CCGGCTTGAATGCTACATCCAGTATCTCGAGATACTGGATGTAGCATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-589s1c1
Sequence:CCGGGCGTTGATGATACAGTCCTCTCTCGAGAGAGGACTGTATCATCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-921s1c1
Sequence:CCGGGCTGCTGAGTAAGCGATTGTTCTCGAGAACAATCGCTTACTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152681.1-706s1c1
Sequence:CCGGGAACTCATCTGTTCCCTGATACTCGAGTATCAGGGAACAGATGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152681.1-2028s1c1
Sequence:CCGGGCTGTATATTTCAGTCTGGTTCTCGAGAACCAGACTGAAATATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152681.1-719s1c1
Sequence:CCGGCCCTGATATGTCTCCTCATTTCTCGAGAAATGAGGAGACATATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152681.1-437s1c1
Sequence:CCGGCATTGAAAGTTCAGACGGTTACTCGAGTAACCGTCTGAACTTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks