EMAIL THIS PAGE TO A FRIEND

TMEM194A

transmembrane protein 194A

Synonyms: TMEM194
UniProtKB ID: O14524, Q17R72, Q68DH0, Q6IQ25
Gene ID:
cow(533988) transmembrane protein 194A
sheep(101121417) transmembrane protein 194A
domestic guinea pig(100715540) transmembrane protein 194A
naked mole-rat(101726589) transmembrane protein 194A
Zebrafish(555733) transmembrane protein 194A
domestic cat(101081061) transmembrane protein 194A
dog(607350) transmembrane protein 194A
chicken(769312) transmembrane protein 194A
253 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015257 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039521 MISSION® esiRNA esiRNA human TMEM194A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015257 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061050 predicted 1012
2 SASI_Hs01_00061051 predicted 869
3 SASI_Hs01_00061052 predicted 200
4 SASI_Hs01_00061053 predicted 691
5 SASI_Hs01_00061054 predicted 254
6 SASI_Hs01_00061055 predicted 411
7 SASI_Hs01_00061056 predicted 1124
8 SASI_Hs01_00061057 predicted 237
9 SASI_Hs01_00061058 predicted 836
10 SASI_Hs02_00347397 predicted 707
11 SASI_Hs01_00061059 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015257
VALIDATED
TMEM194A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 194A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-335s21c1
Sequence:CCGGAGCTAGAGCAAAGTCAAATTTCTCGAGAAATTTGACTTTGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-737s21c1
Sequence:CCGGAGAACCTGGAACACCCTATTCCTCGAGGAATAGGGTGTTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-1073s21c1
Sequence:CCGGCTGAGGAGGAGGACTCATATTCTCGAGAATATGAGTCCTCCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-681s21c1
Sequence:CCGGTGGCATCCAGATACCACATATCTCGAGATATGTGGTATCTGGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015257.1-5164s21c1
Sequence:CCGGGGTAATACCTTAGGGTTATTTCTCGAGAAATAACCCTAAGGTATTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015257.1-4083s1c1
Sequence:CCGGCGTCTGTTACAAAGGGAATTTCTCGAGAAATTCCCTTTGTAACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015257.1-917s1c1
Sequence:CCGGCTTGGAAGACTGTTTCTCGAACTCGAGTTCGAGAAACAGTCTTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_015257.1-392s1c1
Sequence:CCGGCCTCTCTGCTAATCATCATTTCTCGAGAAATGATGATTAGCAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015257.1-273s1c1
Sequence:CCGGCCGAGTAAATAGTTCCAGATTCTCGAGAATCTGGAACTATTTACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015257.1-608s1c1
Sequence:CCGGCCTTGGAGAATGAACGAAGTACTCGAGTACTTCGTTCATTCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015257.1-1034s1c1
Sequence:CCGGGCATTATTGCCCAGGATGAAACTCGAGTTTCATCCTGGGCAATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015257.1-1212s1c1
Sequence:CCGGCCTTTGAAACAGAGTGAGATACTCGAGTATCTCACTCTGTTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015257.1-841s1c1
Sequence:CCGGCGGATACAAGGAGAGGTAGAACTCGAGTTCTACCTCTCCTTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015257
VALIDATED
TMEM194A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 194A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-335s21c1
Sequence:CCGGAGCTAGAGCAAAGTCAAATTTCTCGAGAAATTTGACTTTGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-737s21c1
Sequence:CCGGAGAACCTGGAACACCCTATTCCTCGAGGAATAGGGTGTTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-1073s21c1
Sequence:CCGGCTGAGGAGGAGGACTCATATTCTCGAGAATATGAGTCCTCCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-681s21c1
Sequence:CCGGTGGCATCCAGATACCACATATCTCGAGATATGTGGTATCTGGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015257.1-5164s21c1
Sequence:CCGGGGTAATACCTTAGGGTTATTTCTCGAGAAATAACCCTAAGGTATTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015257.1-4083s1c1
Sequence:CCGGCGTCTGTTACAAAGGGAATTTCTCGAGAAATTCCCTTTGTAACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015257.1-917s1c1
Sequence:CCGGCTTGGAAGACTGTTTCTCGAACTCGAGTTCGAGAAACAGTCTTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_015257.1-392s1c1
Sequence:CCGGCCTCTCTGCTAATCATCATTTCTCGAGAAATGATGATTAGCAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015257.1-273s1c1
Sequence:CCGGCCGAGTAAATAGTTCCAGATTCTCGAGAATCTGGAACTATTTACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015257.1-608s1c1
Sequence:CCGGCCTTGGAGAATGAACGAAGTACTCGAGTACTTCGTTCATTCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015257.1-1034s1c1
Sequence:CCGGGCATTATTGCCCAGGATGAAACTCGAGTTTCATCCTGGGCAATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015257.1-1212s1c1
Sequence:CCGGCCTTTGAAACAGAGTGAGATACTCGAGTATCTCACTCTGTTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015257.1-841s1c1
Sequence:CCGGCGGATACAAGGAGAGGTAGAACTCGAGTTCTACCTCTCCTTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015257
VALIDATED
TMEM194A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 194A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-335s21c1
Sequence:CCGGAGCTAGAGCAAAGTCAAATTTCTCGAGAAATTTGACTTTGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-737s21c1
Sequence:CCGGAGAACCTGGAACACCCTATTCCTCGAGGAATAGGGTGTTCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-1073s21c1
Sequence:CCGGCTGAGGAGGAGGACTCATATTCTCGAGAATATGAGTCCTCCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015257.1-681s21c1
Sequence:CCGGTGGCATCCAGATACCACATATCTCGAGATATGTGGTATCTGGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015257.1-5164s21c1
Sequence:CCGGGGTAATACCTTAGGGTTATTTCTCGAGAAATAACCCTAAGGTATTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015257.1-4083s1c1
Sequence:CCGGCGTCTGTTACAAAGGGAATTTCTCGAGAAATTCCCTTTGTAACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015257.1-917s1c1
Sequence:CCGGCTTGGAAGACTGTTTCTCGAACTCGAGTTCGAGAAACAGTCTTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_015257.1-392s1c1
Sequence:CCGGCCTCTCTGCTAATCATCATTTCTCGAGAAATGATGATTAGCAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015257.1-273s1c1
Sequence:CCGGCCGAGTAAATAGTTCCAGATTCTCGAGAATCTGGAACTATTTACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015257.1-608s1c1
Sequence:CCGGCCTTGGAGAATGAACGAAGTACTCGAGTACTTCGTTCATTCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015257.1-1034s1c1
Sequence:CCGGGCATTATTGCCCAGGATGAAACTCGAGTTTCATCCTGGGCAATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015257.1-1212s1c1
Sequence:CCGGCCTTTGAAACAGAGTGAGATACTCGAGTATCTCACTCTGTTTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_015257.1-841s1c1
Sequence:CCGGCGGATACAAGGAGAGGTAGAACTCGAGTTCTACCTCTCCTTGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks