EMAIL THIS PAGE TO A FRIEND

TMEM194B

transmembrane protein 194B

UniProtKB ID: A6NFY4
Gene ID:
Mouse(227094) transmembrane protein 194B
Rat(503257) transmembrane protein 194B
Zebrafish(564612) transmembrane protein 194B
dog(607176) transmembrane protein 194B
domestic cat(101083102) transmembrane protein 194B
chicken(423977) transmembrane protein 194B
naked mole-rat(101723947) transmembrane protein 194B
domestic guinea pig(100724984) transmembrane protein 194B
cow(506133) transmembrane protein 194B
sheep(101119376) transmembrane protein 194B
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001142647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001142647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001142647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001142645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001142645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001142645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723469 Rosetta Predictions human pricing
XM_001723498 Rosetta Predictions human pricing
XM_001726342 Rosetta Predictions human pricing
NM_001134642 Rosetta Predictions rat pricing
NM_172654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455541 predicted 1090
2 SASI_Hs02_00455542 predicted 1173
3 SASI_Hs02_00455543 predicted 997
4 SASI_Hs02_00455544 predicted 1262
5 SASI_Hs02_00455545 predicted 1243
6 SASI_Hs02_00455546 predicted 737
7 SASI_Hs02_00455547 predicted 1381
8 SASI_Hs02_00455548 predicted 637
9 SASI_Hs02_00455549 predicted 1340
10 SASI_Hs02_00455550 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455700 predicted 1096
2 SASI_Hs02_00455701 predicted 1174
3 SASI_Hs02_00455702 predicted 1006
4 SASI_Hs02_00455703 predicted 1046
5 SASI_Hs02_00455704 predicted 1259
6 SASI_Hs02_00455705 predicted 1250
7 SASI_Hs02_00455706 predicted 736
8 SASI_Hs02_00455707 predicted 635
9 SASI_Hs02_00455708 predicted 1336
10 SASI_Hs02_00455709 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00473692 predicted 1095
2 SASI_Hs02_00473693 predicted 1177
3 SASI_Hs02_00473694 predicted 1001
4 SASI_Hs02_00473695 predicted 1259
5 SASI_Hs02_00473696 predicted 1249
6 SASI_Hs02_00473697 predicted 738
7 SASI_Hs02_00473698 predicted 1382
8 SASI_Hs02_00473699 predicted 639
9 SASI_Hs02_00473700 predicted 1340
10 SASI_Hs02_00473701 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257899 predicted 651
2 SASI_Rn02_00257900 predicted 878
3 SASI_Rn02_00257901 predicted 724
4 SASI_Rn02_00257902 predicted 241
5 SASI_Rn02_00257903 predicted 633
6 SASI_Rn02_00257904 predicted 444
7 SASI_Rn02_00257905 predicted 559
8 SASI_Rn02_00257906 predicted 427
9 SASI_Rn02_00257907 predicted 599
10 SASI_Rn02_00257908 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128069 predicted 678
2 SASI_Mm01_00128070 predicted 446
3 SASI_Mm01_00128071 predicted 602
4 SASI_Mm01_00128072 predicted 454
5 SASI_Mm01_00128073 predicted 563
6 SASI_Mm01_00128074 predicted 371
7 SASI_Mm01_00128075 predicted 358
8 SASI_Mm01_00128076 predicted 573
9 SASI_Mm01_00128077 predicted 696
10 SASI_Mm01_00128078 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172654
TMEM194B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 194B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172654.1-442s1c1
Sequence:CCGGCGTGAGTCGAAACATTGTGGACTCGAGTCCACAATGTTTCGACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172654.1-1403s1c1
Sequence:CCGGGCCCTGAATGAAGACCTTCATCTCGAGATGAAGGTCTTCATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172654.1-1438s1c1
Sequence:CCGGCCTGTTCTTTAGGACCAGTAACTCGAGTTACTGGTCCTAAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172654.1-660s1c1
Sequence:CCGGGCTGTGGTATGGAAACAGAATCTCGAGATTCTGTTTCCATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172654.1-437s1c1
Sequence:CCGGGTAAGCGTGAGTCGAAACATTCTCGAGAATGTTTCGACTCACGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172654.1-282s1c1
Sequence:CCGGGCCAGCACACAGAAAGCATTTCTCGAGAAATGCTTTCTGTGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.1-123s1c1
Sequence:CCGGCTCTGAAGGAAACGGACTTAACTCGAGTTAAGTCCGTTTCCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.1-555s1c1
Sequence:CCGGGTACCGTGTTAGGTATTCTAACTCGAGTTAGAATACCTAACACGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.1-171s1c1
Sequence:CCGGGCTACAATCAACATTCGCAAACTCGAGTTTGCGAATGTTGATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.2-605s1c1
Sequence:CCGGGAAACACATTCCAAAGTTTATCTCGAGATAAACTTTGGAATGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172654
TMEM194B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 194B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172654.1-442s1c1
Sequence:CCGGCGTGAGTCGAAACATTGTGGACTCGAGTCCACAATGTTTCGACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172654.1-1403s1c1
Sequence:CCGGGCCCTGAATGAAGACCTTCATCTCGAGATGAAGGTCTTCATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172654.1-1438s1c1
Sequence:CCGGCCTGTTCTTTAGGACCAGTAACTCGAGTTACTGGTCCTAAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172654.1-660s1c1
Sequence:CCGGGCTGTGGTATGGAAACAGAATCTCGAGATTCTGTTTCCATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172654.1-437s1c1
Sequence:CCGGGTAAGCGTGAGTCGAAACATTCTCGAGAATGTTTCGACTCACGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172654.1-282s1c1
Sequence:CCGGGCCAGCACACAGAAAGCATTTCTCGAGAAATGCTTTCTGTGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.1-123s1c1
Sequence:CCGGCTCTGAAGGAAACGGACTTAACTCGAGTTAAGTCCGTTTCCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.1-555s1c1
Sequence:CCGGGTACCGTGTTAGGTATTCTAACTCGAGTTAGAATACCTAACACGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.1-171s1c1
Sequence:CCGGGCTACAATCAACATTCGCAAACTCGAGTTTGCGAATGTTGATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.2-605s1c1
Sequence:CCGGGAAACACATTCCAAAGTTTATCTCGAGATAAACTTTGGAATGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172654
TMEM194B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 194B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172654.1-442s1c1
Sequence:CCGGCGTGAGTCGAAACATTGTGGACTCGAGTCCACAATGTTTCGACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172654.1-1403s1c1
Sequence:CCGGGCCCTGAATGAAGACCTTCATCTCGAGATGAAGGTCTTCATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181252    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172654.1-1438s1c1
Sequence:CCGGCCTGTTCTTTAGGACCAGTAACTCGAGTTACTGGTCCTAAAGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172654.1-660s1c1
Sequence:CCGGGCTGTGGTATGGAAACAGAATCTCGAGATTCTGTTTCCATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172654.1-437s1c1
Sequence:CCGGGTAAGCGTGAGTCGAAACATTCTCGAGAATGTTTCGACTCACGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172654.1-282s1c1
Sequence:CCGGGCCAGCACACAGAAAGCATTTCTCGAGAAATGCTTTCTGTGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.1-123s1c1
Sequence:CCGGCTCTGAAGGAAACGGACTTAACTCGAGTTAAGTCCGTTTCCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.1-555s1c1
Sequence:CCGGGTACCGTGTTAGGTATTCTAACTCGAGTTAGAATACCTAACACGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.1-171s1c1
Sequence:CCGGGCTACAATCAACATTCGCAAACTCGAGTTTGCGAATGTTGATTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172654.2-605s1c1
Sequence:CCGGGAAACACATTCCAAAGTTTATCTCGAGATAAACTTTGGAATGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142647
TMEM194B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 194B
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000430153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142647.1-1735s21c1
Sequence:CCGGGGTTAACTCAGAGTCATATATCTCGAGATATATGACTCTGAGTTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142647.1-191s21c1
Sequence:CCGGTTCTGTGTCAGACTGCTATTGCTCGAGCAATAGCAGTCTGACACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142647
TMEM194B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 194B
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000430153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142647.1-1735s21c1
Sequence:CCGGGGTTAACTCAGAGTCATATATCTCGAGATATATGACTCTGAGTTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142647.1-191s21c1
Sequence:CCGGTTCTGTGTCAGACTGCTATTGCTCGAGCAATAGCAGTCTGACACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142647
TMEM194B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 194B
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000430153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142647.1-1735s21c1
Sequence:CCGGGGTTAACTCAGAGTCATATATCTCGAGATATATGACTCTGAGTTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142647.1-191s21c1
Sequence:CCGGTTCTGTGTCAGACTGCTATTGCTCGAGCAATAGCAGTCTGACACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142645
TMEM194B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 194B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-427s21c1
Sequence:CCGGTCTAACGAAATAACCATAATCCTCGAGGATTATGGTTATTTCGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-178s21c1
Sequence:CCGGTTATCAGTTCGTAGGTGTAAACTCGAGTTTACACCTACGAACTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-640s21c1
Sequence:CCGGCTAGGTGTTCTAATGACATTACTCGAGTAATGTCATTAGAACACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142645.1-1660s21c1
Sequence:CCGGGTCGACACCAGGGCACTAAATCTCGAGATTTAGTGCCCTGGTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-338s21c1
Sequence:CCGGATATCGCAGAAAGACATAATTCTCGAGAATTATGTCTTTCTGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142645
TMEM194B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 194B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-427s21c1
Sequence:CCGGTCTAACGAAATAACCATAATCCTCGAGGATTATGGTTATTTCGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-178s21c1
Sequence:CCGGTTATCAGTTCGTAGGTGTAAACTCGAGTTTACACCTACGAACTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-640s21c1
Sequence:CCGGCTAGGTGTTCTAATGACATTACTCGAGTAATGTCATTAGAACACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142645.1-1660s21c1
Sequence:CCGGGTCGACACCAGGGCACTAAATCTCGAGATTTAGTGCCCTGGTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-338s21c1
Sequence:CCGGATATCGCAGAAAGACATAATTCTCGAGAATTATGTCTTTCTGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142645
TMEM194B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 194B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-427s21c1
Sequence:CCGGTCTAACGAAATAACCATAATCCTCGAGGATTATGGTTATTTCGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-178s21c1
Sequence:CCGGTTATCAGTTCGTAGGTGTAAACTCGAGTTTACACCTACGAACTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-640s21c1
Sequence:CCGGCTAGGTGTTCTAATGACATTACTCGAGTAATGTCATTAGAACACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142645.1-1660s21c1
Sequence:CCGGGTCGACACCAGGGCACTAAATCTCGAGATTTAGTGCCCTGGTGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142645.1-338s21c1
Sequence:CCGGATATCGCAGAAAGACATAATTCTCGAGAATTATGTCTTTCTGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks