EMAIL THIS PAGE TO A FRIEND

TMEM196

transmembrane protein 196

UniProtKB ID: Q5HYL7, Q8N6I6
Gene ID:
Mouse(217951) transmembrane protein 196
Rat(500750) transmembrane protein 196
cow(100140139) transmembrane protein 196
sheep(101107015) transmembrane protein 196
domestic guinea pig(100732842) transmembrane protein 196
naked mole-rat(101704273) transmembrane protein 196
chicken(772254) transmembrane protein 196
domestic cat(101087218) transmembrane protein 196
dog(100687097) transmembrane protein 196
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001160385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152774 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103511 MISSION® esiRNA esiRNA human TMEM196 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152774 Rosetta Predictions human pricing
NM_001044269 Rosetta Predictions rat pricing
XM_147716 Rosetta Predictions mouse pricing
XM_901373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058361 predicted 1132
2 SASI_Hs01_00058362 predicted 1492
3 SASI_Hs01_00058363 predicted 1400
4 SASI_Hs01_00058364 predicted 1508
5 SASI_Hs01_00058365 predicted 1511
6 SASI_Hs01_00058366 predicted 1705
7 SASI_Hs01_00058367 predicted 1520
8 SASI_Hs02_00366715 predicted 1602
9 SASI_Hs01_00058368 predicted 1541
10 SASI_Hs01_00058369 predicted 1653
11 SASI_Hs01_00058370 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205364 predicted 999
2 SASI_Rn02_00205365 predicted 1007
3 SASI_Rn02_00205366 predicted 818
4 SASI_Rn02_00205367 predicted 706
5 SASI_Rn02_00205368 predicted 709
6 SASI_Rn02_00205369 predicted 951
7 SASI_Rn02_00205370 predicted 531
8 SASI_Rn02_00205371 predicted 932
9 SASI_Rn02_00205372 predicted 830
10 SASI_Rn02_00205373 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_147716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213328 predicted 918
2 SASI_Mm01_00213329 predicted 1214
3 SASI_Mm01_00213330 predicted 1323
4 SASI_Mm01_00213331 predicted 711
5 SASI_Mm01_00213332 predicted 1228
6 SASI_Mm01_00213333 predicted 1376
7 SASI_Mm01_00213334 predicted 1064
8 SASI_Mm01_00213335 predicted 1120
9 SASI_Mm01_00213336 predicted 1215
10 SASI_Mm01_00213337 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430153 predicted 710
2 SASI_Mm02_00430154 predicted 1127
3 SASI_Mm02_00430155 predicted 918
4 SASI_Mm02_00430156 predicted 1188
5 SASI_Mm02_00430157 predicted 704
6 SASI_Mm02_00430158 predicted 1055
7 SASI_Mm01_00220935 predicted 1107
8 SASI_Mm02_00430159 predicted 995
9 SASI_Mm01_00220937 predicted 1120
10 SASI_Mm02_00430160 predicted 709
11 SASI_Mm01_00220928 predicted 1208
12 SASI_Mm01_00220929 predicted 1201
13 SASI_Mm01_00220930 predicted 1145
14 SASI_Mm01_00220931 predicted 1139
15 SASI_Mm01_00220932 predicted 1142
16 SASI_Mm01_00220933 predicted 1175
17 SASI_Mm01_00220934 predicted 1184
18 SASI_Mm01_00220936 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160385
TMEM196 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 196
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-752s21c1
Sequence:CCGGCATTGGAGGCATCCTGAATTTCTCGAGAAATTCAGGATGCCTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-975s21c1
Sequence:CCGGATGACAGACAACATGAGTAATCTCGAGATTACTCATGTTGTCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-997s21c1
Sequence:CCGGGAGCACCGCAACTGATGTTTACTCGAGTAAACATCAGTTGCGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-941s21c1
Sequence:CCGGCCTGCATCACTCTCATGAAATCTCGAGATTTCATGAGAGTGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-822s21c1
Sequence:CCGGCATCTCGCTTCCATGTCTTTGCTCGAGCAAAGACATGGAAGCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160385
TMEM196 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 196
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-752s21c1
Sequence:CCGGCATTGGAGGCATCCTGAATTTCTCGAGAAATTCAGGATGCCTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-975s21c1
Sequence:CCGGATGACAGACAACATGAGTAATCTCGAGATTACTCATGTTGTCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-997s21c1
Sequence:CCGGGAGCACCGCAACTGATGTTTACTCGAGTAAACATCAGTTGCGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-941s21c1
Sequence:CCGGCCTGCATCACTCTCATGAAATCTCGAGATTTCATGAGAGTGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-822s21c1
Sequence:CCGGCATCTCGCTTCCATGTCTTTGCTCGAGCAAAGACATGGAAGCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160385
TMEM196 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 196
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-752s21c1
Sequence:CCGGCATTGGAGGCATCCTGAATTTCTCGAGAAATTCAGGATGCCTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-975s21c1
Sequence:CCGGATGACAGACAACATGAGTAATCTCGAGATTACTCATGTTGTCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-997s21c1
Sequence:CCGGGAGCACCGCAACTGATGTTTACTCGAGTAAACATCAGTTGCGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-941s21c1
Sequence:CCGGCCTGCATCACTCTCATGAAATCTCGAGATTTCATGAGAGTGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160385.1-822s21c1
Sequence:CCGGCATCTCGCTTCCATGTCTTTGCTCGAGCAAAGACATGGAAGCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152774
TMEM196 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 196
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152774.2-3055s1c1
Sequence:CCGGCCCAATTCCTTTGGATAACTTCTCGAGAAGTTATCCAAAGGAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.2-1082s1c1
Sequence:CCGGCCAGTTATGAACAGAGGAGGACTCGAGTCCTCCTCTGTTCATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1098s1c1
Sequence:CCGGGAGGATGTTCTCAGAAAGGGACTCGAGTCCCTTTCTGAGAACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1083s1c1
Sequence:CCGGCAGTTATGAACAGAGGAGGATCTCGAGATCCTCCTCTGTTCATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1085s1c1
Sequence:CCGGGTTATGAACAGAGGAGGATGTCTCGAGACATCCTCCTCTGTTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.1-238s1c1
Sequence:CCGGGCACTCTCTCTTCCTGGCTCACTCGAGTGAGCCAGGAAGAGAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.1-323s1c1
Sequence:CCGGCTCTCATGAAATGGCTGAGAACTCGAGTTCTCAGCCATTTCATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.2-1186s1c1
Sequence:CCGGCCACAGCTGATATTTAATGGACTCGAGTCCATTAAATATCAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1138s1c1
Sequence:CCGGCATGAAATGGCTGAGAAAGAACTCGAGTTCTTTCTCAGCCATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152774
TMEM196 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 196
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152774.2-3055s1c1
Sequence:CCGGCCCAATTCCTTTGGATAACTTCTCGAGAAGTTATCCAAAGGAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.2-1082s1c1
Sequence:CCGGCCAGTTATGAACAGAGGAGGACTCGAGTCCTCCTCTGTTCATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1098s1c1
Sequence:CCGGGAGGATGTTCTCAGAAAGGGACTCGAGTCCCTTTCTGAGAACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1083s1c1
Sequence:CCGGCAGTTATGAACAGAGGAGGATCTCGAGATCCTCCTCTGTTCATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1085s1c1
Sequence:CCGGGTTATGAACAGAGGAGGATGTCTCGAGACATCCTCCTCTGTTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.1-238s1c1
Sequence:CCGGGCACTCTCTCTTCCTGGCTCACTCGAGTGAGCCAGGAAGAGAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.1-323s1c1
Sequence:CCGGCTCTCATGAAATGGCTGAGAACTCGAGTTCTCAGCCATTTCATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.2-1186s1c1
Sequence:CCGGCCACAGCTGATATTTAATGGACTCGAGTCCATTAAATATCAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1138s1c1
Sequence:CCGGCATGAAATGGCTGAGAAAGAACTCGAGTTCTTTCTCAGCCATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152774
TMEM196 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 196
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152774.2-3055s1c1
Sequence:CCGGCCCAATTCCTTTGGATAACTTCTCGAGAAGTTATCCAAAGGAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.2-1082s1c1
Sequence:CCGGCCAGTTATGAACAGAGGAGGACTCGAGTCCTCCTCTGTTCATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1098s1c1
Sequence:CCGGGAGGATGTTCTCAGAAAGGGACTCGAGTCCCTTTCTGAGAACATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1083s1c1
Sequence:CCGGCAGTTATGAACAGAGGAGGATCTCGAGATCCTCCTCTGTTCATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1085s1c1
Sequence:CCGGGTTATGAACAGAGGAGGATGTCTCGAGACATCCTCCTCTGTTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.1-238s1c1
Sequence:CCGGGCACTCTCTCTTCCTGGCTCACTCGAGTGAGCCAGGAAGAGAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.1-323s1c1
Sequence:CCGGCTCTCATGAAATGGCTGAGAACTCGAGTTCTCAGCCATTTCATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152774.2-1186s1c1
Sequence:CCGGCCACAGCTGATATTTAATGGACTCGAGTCCATTAAATATCAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152774.2-1138s1c1
Sequence:CCGGCATGAAATGGCTGAGAAAGAACTCGAGTTCTTTCTCAGCCATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks