EMAIL THIS PAGE TO A FRIEND

TMEM198

transmembrane protein 198

Synonyms: TMEM198A
UniProtKB ID: Q66K66
Gene ID:
Mouse(319998) transmembrane protein 198
Rat(100361928) transmembrane protein 198
chicken(769377) transmembrane protein 198
domestic cat(101098247) transmembrane protein 198
dog(610690) transmembrane protein 198
naked mole-rat(101708398) transmembrane protein 198
Domestic Rabbit(100328893) transmembrane protein 198
cow(768235) transmembrane protein 198
sheep(101114339) transmembrane protein 198
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001005209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005209 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005209 Rosetta Predictions human pricing
NM_177056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218691 predicted 1460
2 SASI_Hs01_00218692 predicted 640
3 SASI_Hs01_00218693 predicted 1477
4 SASI_Hs01_00218694 predicted 1330
5 SASI_Hs01_00218696 predicted 595
6 SASI_Hs02_00304782 predicted 1466
7 SASI_Hs01_00218697 predicted 958
8 SASI_Hs01_00218698 predicted 1404
9 SASI_Hs01_00218699 predicted 1075
10 SASI_Hs01_00218700 predicted 525
11 SASI_Hs01_00218695 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088343 predicted 1970
2 SASI_Mm01_00088344 predicted 1920
3 SASI_Mm01_00088345 predicted 1588
4 SASI_Mm01_00088346 predicted 1905
5 SASI_Mm01_00088347 predicted 1958
6 SASI_Mm01_00088348 predicted 2180
7 SASI_Mm01_00088349 predicted 1445
8 SASI_Mm01_00088350 predicted 1413
9 SASI_Mm02_00347018 predicted 766
10 SASI_Mm02_00347019 predicted 1453
11 SASI_Mm01_00088351 predicted 2041
12 SASI_Mm01_00088352 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177056
TMEM198 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 198
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177056.2-1634s1c1
Sequence:CCGGGAGCTCTCTGAGTTCCTTCATCTCGAGATGAAGGAACTCAGAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177056.3-2157s21c1
Sequence:CCGGTGCTCTATCTTCCAATCATTCCTCGAGGAATGATTGGAAGATAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-1054s21c1
Sequence:CCGGACTAGGCTCTGCACCCTATTACTCGAGTAATAGGGTGCAGAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-1560s21c1
Sequence:CCGGTGCCCATCAAACGCTTCAATGCTCGAGCATTGAAGCGTTTGATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-798s21c1
Sequence:CCGGGAGTCGTCTACTGCTTCTTTGCTCGAGCAAAGAAGCAGTAGACGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-1665s21c1
Sequence:CCGGCAGACACGGACTATGAGTATGCTCGAGCATACTCATAGTCCGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177056
TMEM198 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 198
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177056.2-1634s1c1
Sequence:CCGGGAGCTCTCTGAGTTCCTTCATCTCGAGATGAAGGAACTCAGAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177056.3-2157s21c1
Sequence:CCGGTGCTCTATCTTCCAATCATTCCTCGAGGAATGATTGGAAGATAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-1054s21c1
Sequence:CCGGACTAGGCTCTGCACCCTATTACTCGAGTAATAGGGTGCAGAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-1560s21c1
Sequence:CCGGTGCCCATCAAACGCTTCAATGCTCGAGCATTGAAGCGTTTGATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-798s21c1
Sequence:CCGGGAGTCGTCTACTGCTTCTTTGCTCGAGCAAAGAAGCAGTAGACGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-1665s21c1
Sequence:CCGGCAGACACGGACTATGAGTATGCTCGAGCATACTCATAGTCCGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177056
TMEM198 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 198
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177056.2-1634s1c1
Sequence:CCGGGAGCTCTCTGAGTTCCTTCATCTCGAGATGAAGGAACTCAGAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177056.3-2157s21c1
Sequence:CCGGTGCTCTATCTTCCAATCATTCCTCGAGGAATGATTGGAAGATAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-1054s21c1
Sequence:CCGGACTAGGCTCTGCACCCTATTACTCGAGTAATAGGGTGCAGAGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-1560s21c1
Sequence:CCGGTGCCCATCAAACGCTTCAATGCTCGAGCATTGAAGCGTTTGATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-798s21c1
Sequence:CCGGGAGTCGTCTACTGCTTCTTTGCTCGAGCAAAGAAGCAGTAGACGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177056.3-1665s21c1
Sequence:CCGGCAGACACGGACTATGAGTATGCTCGAGCATACTCATAGTCCGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005209
TMEM198 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 198
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-1187s1c1
Sequence:CCGGCAGGAAGATCGCAAGGAGAAACTCGAGTTTCTCCTTGCGATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-528s1c1
Sequence:CCGGGCTGTTTGTTTGGAGTCGTCTCTCGAGAGACGACTCCAAACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-523s1c1
Sequence:CCGGCATGTGCTGTTTGTTTGGAGTCTCGAGACTCCAAACAAACAGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005209.1-1801s1c1
Sequence:CCGGGATTTCTGACTGGTAGGGTTTCTCGAGAAACCCTACCAGTCAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005209.1-1735s1c1
Sequence:CCGGCGTGTGTCTGTGTGTATGTGTCTCGAGACACATACACACAGACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-544s1c1
Sequence:CCGGCGTCTACTGCTTCTTCGGTTACTCGAGTAACCGAAGAAGCAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-1302s21c1
Sequence:CCGGTGCCCATCAAACGCTTCAATGCTCGAGCATTGAAGCGTTTGATGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-1463s21c1
Sequence:CCGGCCAGTGCGGGTATAGCCATATCTCGAGATATGGCTATACCCGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-604s21c1
Sequence:CCGGGTTTGGCTCGGTGGTCATCTTCTCGAGAAGATGACCACCGAGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-1407s21c1
Sequence:CCGGCAGATGCGGACTATGAGTATGCTCGAGCATACTCATAGTCCGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005209
TMEM198 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 198
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-1187s1c1
Sequence:CCGGCAGGAAGATCGCAAGGAGAAACTCGAGTTTCTCCTTGCGATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-528s1c1
Sequence:CCGGGCTGTTTGTTTGGAGTCGTCTCTCGAGAGACGACTCCAAACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-523s1c1
Sequence:CCGGCATGTGCTGTTTGTTTGGAGTCTCGAGACTCCAAACAAACAGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005209.1-1801s1c1
Sequence:CCGGGATTTCTGACTGGTAGGGTTTCTCGAGAAACCCTACCAGTCAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005209.1-1735s1c1
Sequence:CCGGCGTGTGTCTGTGTGTATGTGTCTCGAGACACATACACACAGACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-544s1c1
Sequence:CCGGCGTCTACTGCTTCTTCGGTTACTCGAGTAACCGAAGAAGCAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-1302s21c1
Sequence:CCGGTGCCCATCAAACGCTTCAATGCTCGAGCATTGAAGCGTTTGATGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-1463s21c1
Sequence:CCGGCCAGTGCGGGTATAGCCATATCTCGAGATATGGCTATACCCGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-604s21c1
Sequence:CCGGGTTTGGCTCGGTGGTCATCTTCTCGAGAAGATGACCACCGAGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-1407s21c1
Sequence:CCGGCAGATGCGGACTATGAGTATGCTCGAGCATACTCATAGTCCGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005209
TMEM198 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 198
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-1187s1c1
Sequence:CCGGCAGGAAGATCGCAAGGAGAAACTCGAGTTTCTCCTTGCGATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-528s1c1
Sequence:CCGGGCTGTTTGTTTGGAGTCGTCTCTCGAGAGACGACTCCAAACAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-523s1c1
Sequence:CCGGCATGTGCTGTTTGTTTGGAGTCTCGAGACTCCAAACAAACAGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005209.1-1801s1c1
Sequence:CCGGGATTTCTGACTGGTAGGGTTTCTCGAGAAACCCTACCAGTCAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005209.1-1735s1c1
Sequence:CCGGCGTGTGTCTGTGTGTATGTGTCTCGAGACACATACACACAGACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005209.1-544s1c1
Sequence:CCGGCGTCTACTGCTTCTTCGGTTACTCGAGTAACCGAAGAAGCAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-1302s21c1
Sequence:CCGGTGCCCATCAAACGCTTCAATGCTCGAGCATTGAAGCGTTTGATGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-1463s21c1
Sequence:CCGGCCAGTGCGGGTATAGCCATATCTCGAGATATGGCTATACCCGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-604s21c1
Sequence:CCGGGTTTGGCTCGGTGGTCATCTTCTCGAGAAGATGACCACCGAGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005209.1-1407s21c1
Sequence:CCGGCAGATGCGGACTATGAGTATGCTCGAGCATACTCATAGTCCGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks