EMAIL THIS PAGE TO A FRIEND

TMEM198B

transmembrane protein 198B, pseudogene

Gene ID:
Mouse(73827) transmembrane protein 198b
Rat(500762) transmembrane protein 198b
Zebrafish(564608) transmembrane protein 198b
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU039101 MISSION® esiRNA esiRNA targeting mouse 1110012D08Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721986 Rosetta Predictions human pricing
XM_001721988 Rosetta Predictions human pricing
XM_001721989 Rosetta Predictions human pricing
XM_001722083 Rosetta Predictions human pricing
XM_927712 Rosetta Predictions human pricing
NM_001109281 Rosetta Predictions rat pricing
NM_178066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00446334 predicted 1731
2 SASI_Hs02_00446335 predicted 1563
3 SASI_Hs02_00446336 predicted 1902
4 SASI_Hs02_00446337 predicted 1714
5 SASI_Hs02_00446338 predicted 1603
6 SASI_Hs02_00446339 predicted 1702
7 SASI_Hs02_00446340 predicted 1925
8 SASI_Hs02_00446341 predicted 1616
9 SASI_Hs02_00446342 predicted 1845
10 SASI_Hs02_00446343 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00446354 predicted 1709
2 SASI_Hs02_00446355 predicted 1568
3 SASI_Hs02_00446356 predicted 1884
4 SASI_Hs02_00446357 predicted 1694
5 SASI_Hs02_00446358 predicted 1681
6 SASI_Hs02_00446359 predicted 1901
7 SASI_Hs02_00446360 predicted 1570
8 SASI_Hs02_00446361 predicted 1845
9 SASI_Hs02_00446362 predicted 1821
10 SASI_Hs02_00446363 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00446364 predicted 1711
2 SASI_Hs02_00446365 predicted 1817
3 SASI_Hs02_00446366 predicted 1565
4 SASI_Hs02_00446367 predicted 2002
5 SASI_Hs02_00446368 predicted 1705
6 SASI_Hs02_00446369 predicted 1712
7 SASI_Hs02_00446370 predicted 1681
8 SASI_Hs02_00446371 predicted 2018
9 SASI_Hs02_00446372 predicted 1934
10 SASI_Hs02_00446373 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00447017 predicted 1465
2 SASI_Hs02_00447018 predicted 1508
3 SASI_Hs02_00447019 predicted 1503
4 SASI_Hs02_00447020 predicted 1526
5 SASI_Hs02_00447021 predicted 1471
6 SASI_Hs02_00447022 predicted 1498
7 SASI_Hs02_00447023 predicted 1490
8 SASI_Hs02_00447024 predicted 1465
9 SASI_Hs02_00447025 predicted 1494
10 SASI_Hs02_00447026 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480672 predicted 1847
2 SASI_Hs01_00285022 predicted 1944
3 SASI_Hs01_00285030 predicted 1904
4 SASI_Hs02_00480673 predicted 1914
5 SASI_Hs02_00480674 predicted 1868
6 SASI_Hs02_00480675 predicted 1848
7 SASI_Hs02_00480676 predicted 1919
8 SASI_Hs02_00480677 predicted 1844
9 SASI_Hs01_00285023 predicted 1944
10 SASI_Hs02_00480678 predicted 1868
11 SASI_Hs01_00285024 predicted 768
12 SASI_Hs01_00285025 predicted 662
13 SASI_Hs01_00285026 predicted 442
14 SASI_Hs01_00285027 predicted 964
15 SASI_Hs01_00285028 predicted 941
16 SASI_Hs01_00285029 predicted 549
17 SASI_Hs01_00285031 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246874 predicted 1190
2 SASI_Rn02_00246875 predicted 497
3 SASI_Rn02_00246876 predicted 838
4 SASI_Rn02_00246877 predicted 1129
5 SASI_Rn02_00246878 predicted 941
6 SASI_Rn02_00246879 predicted 1537
7 SASI_Rn02_00246880 predicted 699
8 SASI_Rn02_00246881 predicted 606
9 SASI_Rn02_00246882 predicted 1665
10 SASI_Rn02_00246883 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199846 predicted 983
2 SASI_Mm01_00199847 predicted 238
3 SASI_Mm01_00199848 predicted 1143
4 SASI_Mm01_00199849 predicted 380
5 SASI_Mm01_00199850 predicted 816
6 SASI_Mm01_00199852 predicted 524
7 SASI_Mm01_00199853 predicted 1051
8 SASI_Mm02_00348527 predicted 1091
9 SASI_Mm02_00348528 predicted 461
10 SASI_Mm01_00199854 predicted 415
11 SASI_Mm01_00199845 predicted 370
12 SASI_Mm01_00199851 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178066
VALIDATED
TMEM198B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 198B, pseudogene
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178066.2-1377s1c1
Sequence:CCGGCCTACCTCTTAGACTTGGGAACTCGAGTTCCCAAGTCTAAGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178066.2-382s1c1
Sequence:CCGGGCTTCGGAATCATCTACTGCTCTCGAGAGCAGTAGATGATTCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178066.2-2151s1c1
Sequence:CCGGGCTTTCCTCCTAAACCAGAATCTCGAGATTCTGGTTTAGGAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178066.2-1149s1c1
Sequence:CCGGCCAAGTTATCTCCAGAGTCTTCTCGAGAAGACTCTGGAGATAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178066.2-1146s1c1
Sequence:CCGGGCTCCAAGTTATCTCCAGAGTCTCGAGACTCTGGAGATAACTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178066.2-641s1c1
Sequence:CCGGCTTATTGGGTACTGAACCCATCTCGAGATGGGTTCAGTACCCAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178066
VALIDATED
TMEM198B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 198B, pseudogene
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178066.2-1377s1c1
Sequence:CCGGCCTACCTCTTAGACTTGGGAACTCGAGTTCCCAAGTCTAAGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178066.2-382s1c1
Sequence:CCGGGCTTCGGAATCATCTACTGCTCTCGAGAGCAGTAGATGATTCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178066.2-2151s1c1
Sequence:CCGGGCTTTCCTCCTAAACCAGAATCTCGAGATTCTGGTTTAGGAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178066.2-1149s1c1
Sequence:CCGGCCAAGTTATCTCCAGAGTCTTCTCGAGAAGACTCTGGAGATAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178066.2-1146s1c1
Sequence:CCGGGCTCCAAGTTATCTCCAGAGTCTCGAGACTCTGGAGATAACTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178066.2-641s1c1
Sequence:CCGGCTTATTGGGTACTGAACCCATCTCGAGATGGGTTCAGTACCCAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178066
VALIDATED
TMEM198B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 198B, pseudogene
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178066.2-1377s1c1
Sequence:CCGGCCTACCTCTTAGACTTGGGAACTCGAGTTCCCAAGTCTAAGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178066.2-382s1c1
Sequence:CCGGGCTTCGGAATCATCTACTGCTCTCGAGAGCAGTAGATGATTCCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178066.2-2151s1c1
Sequence:CCGGGCTTTCCTCCTAAACCAGAATCTCGAGATTCTGGTTTAGGAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178066.2-1149s1c1
Sequence:CCGGCCAAGTTATCTCCAGAGTCTTCTCGAGAAGACTCTGGAGATAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178066.2-1146s1c1
Sequence:CCGGGCTCCAAGTTATCTCCAGAGTCTCGAGACTCTGGAGATAACTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178066.2-641s1c1
Sequence:CCGGCTTATTGGGTACTGAACCCATCTCGAGATGGGTTCAGTACCCAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks