EMAIL THIS PAGE TO A FRIEND

TMEM199

transmembrane protein 199

Synonyms: C17orf32
UniProtKB ID: Q8N511
Gene ID:
Mouse(195040) transmembrane protein 199
Rat(303332) transmembrane protein 199
domestic guinea pig(100727670) transmembrane protein 199
naked mole-rat(101704965) transmembrane protein 199
cow(511376) transmembrane protein 199
sheep(101104411) transmembrane protein 199
Zebrafish(100001648) transmembrane protein 199
dog(491163) transmembrane protein 199
domestic cat(101101011) transmembrane protein 199
chicken(417566) transmembrane protein 199
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152464 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152464 Rosetta Predictions human pricing
NM_001024992 Rosetta Predictions rat pricing
NM_199199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214498 predicted 488
2 SASI_Hs01_00214499 predicted 787
3 SASI_Hs01_00214500 predicted 414
4 SASI_Hs02_00366240 predicted 807
5 SASI_Hs01_00214502 predicted 364
6 SASI_Hs01_00214503 predicted 487
7 SASI_Hs01_00214504 predicted 498
8 SASI_Hs01_00214505 predicted 488
9 SASI_Hs01_00214506 predicted 801
10 SASI_Hs01_00214507 predicted 626
11 SASI_Hs01_00214501 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090137 predicted 824
2 SASI_Rn01_00090138 predicted 241
3 SASI_Rn01_00090139 predicted 288
4 SASI_Rn01_00090140 predicted 197
5 SASI_Rn01_00090141 predicted 902
6 SASI_Rn02_00202883 predicted 199
7 SASI_Rn01_00090142 predicted 208
8 SASI_Rn01_00090144 predicted 716
9 SASI_Rn01_00090145 predicted 424
10 SASI_Rn01_00090146 predicted 494
11 SASI_Rn01_00090143 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078612 predicted 303
2 SASI_Mm01_00078613 predicted 351
3 SASI_Mm01_00078614 predicted 564
4 SASI_Mm01_00078615 predicted 420
5 SASI_Mm01_00078616 predicted 559
6 SASI_Mm01_00078617 predicted 261
7 SASI_Mm01_00078618 predicted 553
8 SASI_Mm01_00078619 predicted 211
9 SASI_Mm01_00078620 predicted 859
10 SASI_Mm01_00078621 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199199
VALIDATED
TMEM199 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 199
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199199.1-419s1c1
Sequence:CCGGGTACGTCATGGTAAGGGCAATCTCGAGATTGCCCTTACCATGACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191242    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199199.1-1025s1c1
Sequence:CCGGCGTTACACTGTTCAGAACTTACTCGAGTAAGTTCTGAACAGTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192155    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199199.1-944s1c1
Sequence:CCGGGCCTGAGAGAAATCAGATGATCTCGAGATCATCTGATTTCTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199199.2-1189s21c1
Sequence:CCGGCAGTATGGCCCTCATGTTAAACTCGAGTTTAACATGAGGGCCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-565s21c1
Sequence:CCGGCCAGTATGTCTTCACAGAAATCTCGAGATTTCTGTGAAGACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-229s21c1
Sequence:CCGGATTCCGTCTCATCCGAGATCTCTCGAGAGATCTCGGATGAGACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-388s21c1
Sequence:CCGGGCTAGCCAATGAGGAGTATAACTCGAGTTATACTCCTCATTGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-366s21c1
Sequence:CCGGGGCTAGAGAAGATTAAGATACCTCGAGGTATCTTAATCTTCTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199199
VALIDATED
TMEM199 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 199
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199199.1-419s1c1
Sequence:CCGGGTACGTCATGGTAAGGGCAATCTCGAGATTGCCCTTACCATGACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191242    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199199.1-1025s1c1
Sequence:CCGGCGTTACACTGTTCAGAACTTACTCGAGTAAGTTCTGAACAGTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192155    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199199.1-944s1c1
Sequence:CCGGGCCTGAGAGAAATCAGATGATCTCGAGATCATCTGATTTCTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199199.2-1189s21c1
Sequence:CCGGCAGTATGGCCCTCATGTTAAACTCGAGTTTAACATGAGGGCCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-565s21c1
Sequence:CCGGCCAGTATGTCTTCACAGAAATCTCGAGATTTCTGTGAAGACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-229s21c1
Sequence:CCGGATTCCGTCTCATCCGAGATCTCTCGAGAGATCTCGGATGAGACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-388s21c1
Sequence:CCGGGCTAGCCAATGAGGAGTATAACTCGAGTTATACTCCTCATTGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-366s21c1
Sequence:CCGGGGCTAGAGAAGATTAAGATACCTCGAGGTATCTTAATCTTCTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199199
VALIDATED
TMEM199 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 199
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199199.1-419s1c1
Sequence:CCGGGTACGTCATGGTAAGGGCAATCTCGAGATTGCCCTTACCATGACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191242    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199199.1-1025s1c1
Sequence:CCGGCGTTACACTGTTCAGAACTTACTCGAGTAAGTTCTGAACAGTGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192155    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199199.1-944s1c1
Sequence:CCGGGCCTGAGAGAAATCAGATGATCTCGAGATCATCTGATTTCTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_199199.2-1189s21c1
Sequence:CCGGCAGTATGGCCCTCATGTTAAACTCGAGTTTAACATGAGGGCCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-565s21c1
Sequence:CCGGCCAGTATGTCTTCACAGAAATCTCGAGATTTCTGTGAAGACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-229s21c1
Sequence:CCGGATTCCGTCTCATCCGAGATCTCTCGAGAGATCTCGGATGAGACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-388s21c1
Sequence:CCGGGCTAGCCAATGAGGAGTATAACTCGAGTTATACTCCTCATTGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199199.2-366s21c1
Sequence:CCGGGGCTAGAGAAGATTAAGATACCTCGAGGTATCTTAATCTTCTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152464
VALIDATED
TMEM199 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 199
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152464.1-257s1c1
Sequence:CCGGGAAATCTATCTCCCAGAGGTTCTCGAGAACCTCTGGGAGATAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_152464.1-313s1c1
Sequence:CCGGGCTGGAGAAGATTAAGATACACTCGAGTGTATCTTAATCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152464.1-339s1c1
Sequence:CCGGCCAATGAGGAATATAAACGGACTCGAGTCCGTTTATATTCCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152464.1-244s1c1
Sequence:CCGGCCTAGAAGGCAGTGAAATCTACTCGAGTAGATTTCACTGCCTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152464.1-1311s1c1
Sequence:CCGGCCTATGTTGTTCTGAAGTCTTCTCGAGAAGACTTCAGAACAACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152464.1-340s1c1
Sequence:CCGGCAATGAGGAATATAAACGGATCTCGAGATCCGTTTATATTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152464.1-783s1c1
Sequence:CCGGGCCCTAATCTTCTGTGAATTTCTCGAGAAATTCACAGAAGATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152464.1-334s1c1
Sequence:CCGGGCTGGCCAATGAGGAATATAACTCGAGTTATATTCCTCATTGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152464.1-211s21c1
Sequence:CCGGAGAAAGGGATTCCAAACTATACTCGAGTATAGTTTGGAATCCCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152464.1-814s21c1
Sequence:CCGGCATTGGAGGAGATTGAGATAACTCGAGTTATCTCAATCTCCTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152464
VALIDATED
TMEM199 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 199
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152464.1-257s1c1
Sequence:CCGGGAAATCTATCTCCCAGAGGTTCTCGAGAACCTCTGGGAGATAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_152464.1-313s1c1
Sequence:CCGGGCTGGAGAAGATTAAGATACACTCGAGTGTATCTTAATCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152464.1-339s1c1
Sequence:CCGGCCAATGAGGAATATAAACGGACTCGAGTCCGTTTATATTCCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152464.1-244s1c1
Sequence:CCGGCCTAGAAGGCAGTGAAATCTACTCGAGTAGATTTCACTGCCTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152464.1-1311s1c1
Sequence:CCGGCCTATGTTGTTCTGAAGTCTTCTCGAGAAGACTTCAGAACAACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152464.1-340s1c1
Sequence:CCGGCAATGAGGAATATAAACGGATCTCGAGATCCGTTTATATTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152464.1-783s1c1
Sequence:CCGGGCCCTAATCTTCTGTGAATTTCTCGAGAAATTCACAGAAGATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152464.1-334s1c1
Sequence:CCGGGCTGGCCAATGAGGAATATAACTCGAGTTATATTCCTCATTGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152464.1-211s21c1
Sequence:CCGGAGAAAGGGATTCCAAACTATACTCGAGTATAGTTTGGAATCCCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152464.1-814s21c1
Sequence:CCGGCATTGGAGGAGATTGAGATAACTCGAGTTATCTCAATCTCCTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152464
VALIDATED
TMEM199 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 199
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152464.1-257s1c1
Sequence:CCGGGAAATCTATCTCCCAGAGGTTCTCGAGAACCTCTGGGAGATAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_152464.1-313s1c1
Sequence:CCGGGCTGGAGAAGATTAAGATACACTCGAGTGTATCTTAATCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152464.1-339s1c1
Sequence:CCGGCCAATGAGGAATATAAACGGACTCGAGTCCGTTTATATTCCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152464.1-244s1c1
Sequence:CCGGCCTAGAAGGCAGTGAAATCTACTCGAGTAGATTTCACTGCCTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152464.1-1311s1c1
Sequence:CCGGCCTATGTTGTTCTGAAGTCTTCTCGAGAAGACTTCAGAACAACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152464.1-340s1c1
Sequence:CCGGCAATGAGGAATATAAACGGATCTCGAGATCCGTTTATATTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152464.1-783s1c1
Sequence:CCGGGCCCTAATCTTCTGTGAATTTCTCGAGAAATTCACAGAAGATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152464.1-334s1c1
Sequence:CCGGGCTGGCCAATGAGGAATATAACTCGAGTTATATTCCTCATTGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152464.1-211s21c1
Sequence:CCGGAGAAAGGGATTCCAAACTATACTCGAGTATAGTTTGGAATCCCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152464.1-814s21c1
Sequence:CCGGCATTGGAGGAGATTGAGATAACTCGAGTTATCTCAATCTCCTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks