EMAIL THIS PAGE TO A FRIEND

TMEM19

transmembrane protein 19

UniProtKB ID: Q96HH6, B2RDL2, Q53FY3, Q9NV41
Gene ID:
Mouse(67226) transmembrane protein 19
Rat(299800) transmembrane protein 19
Zebrafish(415188) transmembrane protein 19
domestic cat(101081232) transmembrane protein 19
dog(474450) transmembrane protein 19
chicken(417856) transmembrane protein 19
domestic guinea pig(100730387) transmembrane protein 19
naked mole-rat(101716017) transmembrane protein 19
cow(538974) transmembrane protein 19
sheep(101120066) transmembrane protein 19
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018279 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018279 Rosetta Predictions human pricing
NM_199098 Rosetta Predictions rat pricing
NM_133683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096244 predicted 1226
2 SASI_Hs01_00096246 predicted 1646
3 SASI_Hs01_00096247 predicted 925
4 SASI_Hs01_00096248 predicted 1413
5 SASI_Hs01_00096249 predicted 1654
6 SASI_Hs01_00096250 predicted 583
7 SASI_Hs01_00096251 predicted 1097
8 SASI_Hs01_00096252 predicted 1449
9 SASI_Hs01_00096253 predicted 1479
10 SASI_Hs02_00351652 predicted 633
11 SASI_Hs01_00096245 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055780 predicted 395
2 SASI_Rn01_00055781 predicted 635
3 SASI_Rn01_00055782 predicted 372
4 SASI_Rn01_00055783 predicted 384
5 SASI_Rn01_00055784 predicted 614
6 SASI_Rn01_00055785 predicted 547
7 SASI_Rn02_00270116 predicted 783
8 SASI_Rn01_00055786 predicted 413
9 SASI_Rn01_00055787 predicted 974
10 SASI_Rn01_00055788 predicted 946
11 SASI_Rn01_00055779 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338642 predicted 1651
2 SASI_Mm01_00029640 predicted 271
3 SASI_Mm01_00029641 predicted 1548
4 SASI_Mm01_00029642 predicted 923
5 SASI_Mm01_00029643 predicted 1590
6 SASI_Mm01_00029644 predicted 333
7 SASI_Mm01_00029645 predicted 930
8 SASI_Mm01_00029646 predicted 1694
9 SASI_Mm01_00029647 predicted 284
10 SASI_Mm02_00338643 predicted 1703
11 SASI_Mm01_00029648 predicted 1599
12 SASI_Mm01_00029649 predicted 1563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018279
VALIDATED
TMEM19 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018279.2-2825s1c1
Sequence:CCGGCCCTTAACCTTTAAGCCAGTTCTCGAGAACTGGCTTAAAGGTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-772s1c1
Sequence:CCGGGATCGTCTCTAATGGCCTTAACTCGAGTTAAGGCCATTAGAGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-2765s1c1
Sequence:CCGGCCCTACTATGGTGATGATCTACTCGAGTAGATCATCACCATAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-1373s1c1
Sequence:CCGGGCTGGATTACTAGGATCAATTCTCGAGAATTGATCCTAGTAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-1505s1c1
Sequence:CCGGCTTGATAACAACGCAGTGAATCTCGAGATTCACTGCGTTGTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018279.2-652s1c1
Sequence:CCGGCCTGATCATTTGCATTTCGTTCTCGAGAACGAAATGCAAATGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018279.2-1702s1c1
Sequence:CCGGCCTCCTGTATTCCATTGAGATCTCGAGATCTCAATGGAATACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018279.3-940s21c1
Sequence:CCGGGCGTCTAGATTCAGAATATAACTCGAGTTATATTCTGAATCTAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018279.3-1191s21c1
Sequence:CCGGTGATAACAACCTGGGAGAAAGCTCGAGCTTTCTCCCAGGTTGTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018279.3-1343s21c1
Sequence:CCGGCAGTGGCCAATTATTGCATTTCTCGAGAAATGCAATAATTGGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018279
VALIDATED
TMEM19 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018279.2-2825s1c1
Sequence:CCGGCCCTTAACCTTTAAGCCAGTTCTCGAGAACTGGCTTAAAGGTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-772s1c1
Sequence:CCGGGATCGTCTCTAATGGCCTTAACTCGAGTTAAGGCCATTAGAGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-2765s1c1
Sequence:CCGGCCCTACTATGGTGATGATCTACTCGAGTAGATCATCACCATAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-1373s1c1
Sequence:CCGGGCTGGATTACTAGGATCAATTCTCGAGAATTGATCCTAGTAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-1505s1c1
Sequence:CCGGCTTGATAACAACGCAGTGAATCTCGAGATTCACTGCGTTGTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018279.2-652s1c1
Sequence:CCGGCCTGATCATTTGCATTTCGTTCTCGAGAACGAAATGCAAATGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018279.2-1702s1c1
Sequence:CCGGCCTCCTGTATTCCATTGAGATCTCGAGATCTCAATGGAATACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018279.3-940s21c1
Sequence:CCGGGCGTCTAGATTCAGAATATAACTCGAGTTATATTCTGAATCTAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018279.3-1191s21c1
Sequence:CCGGTGATAACAACCTGGGAGAAAGCTCGAGCTTTCTCCCAGGTTGTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018279.3-1343s21c1
Sequence:CCGGCAGTGGCCAATTATTGCATTTCTCGAGAAATGCAATAATTGGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018279
VALIDATED
TMEM19 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018279.2-2825s1c1
Sequence:CCGGCCCTTAACCTTTAAGCCAGTTCTCGAGAACTGGCTTAAAGGTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-772s1c1
Sequence:CCGGGATCGTCTCTAATGGCCTTAACTCGAGTTAAGGCCATTAGAGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-2765s1c1
Sequence:CCGGCCCTACTATGGTGATGATCTACTCGAGTAGATCATCACCATAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-1373s1c1
Sequence:CCGGGCTGGATTACTAGGATCAATTCTCGAGAATTGATCCTAGTAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018279.2-1505s1c1
Sequence:CCGGCTTGATAACAACGCAGTGAATCTCGAGATTCACTGCGTTGTTATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018279.2-652s1c1
Sequence:CCGGCCTGATCATTTGCATTTCGTTCTCGAGAACGAAATGCAAATGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018279.2-1702s1c1
Sequence:CCGGCCTCCTGTATTCCATTGAGATCTCGAGATCTCAATGGAATACAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018279.3-940s21c1
Sequence:CCGGGCGTCTAGATTCAGAATATAACTCGAGTTATATTCTGAATCTAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018279.3-1191s21c1
Sequence:CCGGTGATAACAACCTGGGAGAAAGCTCGAGCTTTCTCCCAGGTTGTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018279.3-1343s21c1
Sequence:CCGGCAGTGGCCAATTATTGCATTTCTCGAGAAATGCAATAATTGGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133683
VALIDATED
TMEM19 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 19
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133683.1-993s1c1
Sequence:CCGGGCAGTGGCCCATTATTGCATTCTCGAGAATGCAATAATGGGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133683.1-994s1c1
Sequence:CCGGCAGTGGCCCATTATTGCATTTCTCGAGAAATGCAATAATGGGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133683.1-591s1c1
Sequence:CCGGGCAACTGGACTCAGAGTATAACTCGAGTTATACTCTGAGTCCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133683.1-808s1c1
Sequence:CCGGGTTGCTCCAGTTCTGAGCAAACTCGAGTTTGCTCAGAACTGGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133683.1-491s1c1
Sequence:CCGGGATTCATCTTAACCATCGCAACTCGAGTTGCGATGGTTAAGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-992s21c1
Sequence:CCGGCAGTGGCCCATTATTGCATTTCTCGAGAAATGCAATAATGGGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-1038s21c1
Sequence:CCGGCACTCGTGGACTCGTTCTTAGCTCGAGCTAAGAACGAGTCCACGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-1554s21c1
Sequence:CCGGAGCAGTGTGTTGACAATTTAGCTCGAGCTAAATTGTCAACACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133683.3-1427s21c1
Sequence:CCGGGCGTACAAGTTGTCCACATTTCTCGAGAAATGTGGACAACTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-1014s21c1
Sequence:CCGGGTGGTGTGGCTGGGTTATTTGCTCGAGCAAATAACCCAGCCACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133683
VALIDATED
TMEM19 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 19
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133683.1-993s1c1
Sequence:CCGGGCAGTGGCCCATTATTGCATTCTCGAGAATGCAATAATGGGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133683.1-994s1c1
Sequence:CCGGCAGTGGCCCATTATTGCATTTCTCGAGAAATGCAATAATGGGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133683.1-591s1c1
Sequence:CCGGGCAACTGGACTCAGAGTATAACTCGAGTTATACTCTGAGTCCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133683.1-808s1c1
Sequence:CCGGGTTGCTCCAGTTCTGAGCAAACTCGAGTTTGCTCAGAACTGGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133683.1-491s1c1
Sequence:CCGGGATTCATCTTAACCATCGCAACTCGAGTTGCGATGGTTAAGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-992s21c1
Sequence:CCGGCAGTGGCCCATTATTGCATTTCTCGAGAAATGCAATAATGGGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-1038s21c1
Sequence:CCGGCACTCGTGGACTCGTTCTTAGCTCGAGCTAAGAACGAGTCCACGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-1554s21c1
Sequence:CCGGAGCAGTGTGTTGACAATTTAGCTCGAGCTAAATTGTCAACACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133683.3-1427s21c1
Sequence:CCGGGCGTACAAGTTGTCCACATTTCTCGAGAAATGTGGACAACTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-1014s21c1
Sequence:CCGGGTGGTGTGGCTGGGTTATTTGCTCGAGCAAATAACCCAGCCACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133683
VALIDATED
TMEM19 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 19
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133683.1-993s1c1
Sequence:CCGGGCAGTGGCCCATTATTGCATTCTCGAGAATGCAATAATGGGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133683.1-994s1c1
Sequence:CCGGCAGTGGCCCATTATTGCATTTCTCGAGAAATGCAATAATGGGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133683.1-591s1c1
Sequence:CCGGGCAACTGGACTCAGAGTATAACTCGAGTTATACTCTGAGTCCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133683.1-808s1c1
Sequence:CCGGGTTGCTCCAGTTCTGAGCAAACTCGAGTTTGCTCAGAACTGGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133683.1-491s1c1
Sequence:CCGGGATTCATCTTAACCATCGCAACTCGAGTTGCGATGGTTAAGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-992s21c1
Sequence:CCGGCAGTGGCCCATTATTGCATTTCTCGAGAAATGCAATAATGGGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-1038s21c1
Sequence:CCGGCACTCGTGGACTCGTTCTTAGCTCGAGCTAAGAACGAGTCCACGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-1554s21c1
Sequence:CCGGAGCAGTGTGTTGACAATTTAGCTCGAGCTAAATTGTCAACACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133683.3-1427s21c1
Sequence:CCGGGCGTACAAGTTGTCCACATTTCTCGAGAAATGTGGACAACTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133683.3-1014s21c1
Sequence:CCGGGTGGTGTGGCTGGGTTATTTGCTCGAGCAAATAACCCAGCCACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks