EMAIL THIS PAGE TO A FRIEND

TMEM200A

transmembrane protein 200A

Synonyms: KIAA1913 TTMA TTMC
UniProtKB ID: Q86VY9, Q96PX5
Gene ID:
Mouse(77220) transmembrane protein 200A
Rat(498987) transmembrane protein 200A
domestic guinea pig(100734896) transmembrane protein 200A
Domestic Rabbit(100352511) transmembrane protein 200A
naked mole-rat(101699191) transmembrane protein 200A
sheep(101120250) transmembrane protein 200A
Zebrafish(556369) transmembrane protein 200A
chicken(427076) transmembrane protein 200A
domestic cat(101088490) transmembrane protein 200A
Horse(100067472) transmembrane protein 200A
dog(612724) transmembrane protein 200A
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029881 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029881 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029881 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052913 Rosetta Predictions human pricing
NM_001109135 Rosetta Predictions rat pricing
NM_029881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361670 predicted 3244
2 SASI_Hs01_00065180 predicted 3194
3 SASI_Hs01_00065181 predicted 3585
4 SASI_Hs01_00065182 predicted 3531
5 SASI_Hs01_00065183 predicted 2796
6 SASI_Hs01_00065184 predicted 3324
7 SASI_Hs02_00361671 predicted 2989
8 SASI_Hs01_00065185 predicted 3642
9 SASI_Hs01_00065186 predicted 2853
10 SASI_Hs01_00065187 predicted 3944
11 SASI_Hs01_00065188 predicted 3090
12 SASI_Hs01_00065189 predicted 2900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245470 predicted 1810
2 SASI_Rn02_00245471 predicted 2315
3 SASI_Rn02_00245472 predicted 1109
4 SASI_Rn02_00245473 predicted 2076
5 SASI_Rn02_00245474 predicted 2063
6 SASI_Rn02_00245475 predicted 1293
7 SASI_Rn02_00245476 predicted 2493
8 SASI_Rn02_00245477 predicted 1416
9 SASI_Rn02_00245478 predicted 2208
10 SASI_Rn02_00245479 predicted 2360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193560 predicted 2063
2 SASI_Mm01_00193562 predicted 2299
3 SASI_Mm01_00193563 predicted 1279
4 SASI_Mm01_00193564 predicted 2501
5 SASI_Mm01_00193565 predicted 1405
6 SASI_Mm01_00193566 predicted 2290
7 SASI_Mm01_00193567 predicted 2381
8 SASI_Mm01_00193568 predicted 1819
9 SASI_Mm01_00193569 predicted 1821
10 SASI_Mm02_00336106 predicted 1741
11 SASI_Mm01_00193561 predicted 1812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052913
TMEM200A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 200A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052913.2-2909s1c1
Sequence:CCGGGCAAAGGCAAATGAACGGCATCTCGAGATGCCGTTCATTTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052913.2-3603s1c1
Sequence:CCGGGTTCAGGCAGAACAACGGAAACTCGAGTTTCCGTTGTTCTGCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052913.2-3057s1c1
Sequence:CCGGGAGGAGGATGAACTTATGTTACTCGAGTAACATAAGTTCATCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052913.2-4547s1c1
Sequence:CCGGCGTTAGATACTCGGAATCAAACTCGAGTTTGATTCCGAGTATCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052913.2-2585s1c1
Sequence:CCGGGCTCATCTCCATTATAGGAATCTCGAGATTCCTATAATGGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052913.2-4498s1c1
Sequence:CCGGCCAGATATACTTAGGGATAAACTCGAGTTTATCCCTAAGTATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052913.2-3447s21c1
Sequence:CCGGAGTCAGTACAAGTCATCTATGCTCGAGCATAGATGACTTGTACTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052913.2-2581s21c1
Sequence:CCGGGAGTGCTCATCTCCATTATAGCTCGAGCTATAATGGAGATGAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052913.2-4312s21c1
Sequence:CCGGGTAGGATTTGGTTACATTATTCTCGAGAATAATGTAACCAAATCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052913
TMEM200A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 200A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052913.2-2909s1c1
Sequence:CCGGGCAAAGGCAAATGAACGGCATCTCGAGATGCCGTTCATTTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052913.2-3603s1c1
Sequence:CCGGGTTCAGGCAGAACAACGGAAACTCGAGTTTCCGTTGTTCTGCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052913.2-3057s1c1
Sequence:CCGGGAGGAGGATGAACTTATGTTACTCGAGTAACATAAGTTCATCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052913.2-4547s1c1
Sequence:CCGGCGTTAGATACTCGGAATCAAACTCGAGTTTGATTCCGAGTATCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052913.2-2585s1c1
Sequence:CCGGGCTCATCTCCATTATAGGAATCTCGAGATTCCTATAATGGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052913.2-4498s1c1
Sequence:CCGGCCAGATATACTTAGGGATAAACTCGAGTTTATCCCTAAGTATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052913.2-3447s21c1
Sequence:CCGGAGTCAGTACAAGTCATCTATGCTCGAGCATAGATGACTTGTACTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052913.2-2581s21c1
Sequence:CCGGGAGTGCTCATCTCCATTATAGCTCGAGCTATAATGGAGATGAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052913.2-4312s21c1
Sequence:CCGGGTAGGATTTGGTTACATTATTCTCGAGAATAATGTAACCAAATCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052913
TMEM200A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 200A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052913.2-2909s1c1
Sequence:CCGGGCAAAGGCAAATGAACGGCATCTCGAGATGCCGTTCATTTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052913.2-3603s1c1
Sequence:CCGGGTTCAGGCAGAACAACGGAAACTCGAGTTTCCGTTGTTCTGCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052913.2-3057s1c1
Sequence:CCGGGAGGAGGATGAACTTATGTTACTCGAGTAACATAAGTTCATCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052913.2-4547s1c1
Sequence:CCGGCGTTAGATACTCGGAATCAAACTCGAGTTTGATTCCGAGTATCTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052913.2-2585s1c1
Sequence:CCGGGCTCATCTCCATTATAGGAATCTCGAGATTCCTATAATGGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052913.2-4498s1c1
Sequence:CCGGCCAGATATACTTAGGGATAAACTCGAGTTTATCCCTAAGTATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052913.2-3447s21c1
Sequence:CCGGAGTCAGTACAAGTCATCTATGCTCGAGCATAGATGACTTGTACTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052913.2-2581s21c1
Sequence:CCGGGAGTGCTCATCTCCATTATAGCTCGAGCTATAATGGAGATGAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052913.2-4312s21c1
Sequence:CCGGGTAGGATTTGGTTACATTATTCTCGAGAATAATGTAACCAAATCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029881
TMEM200A MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 200A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029881.1-1967s1c1
Sequence:CCGGGTAACAACTTGAAGCGAGGAACTCGAGTTCCTCGCTTCAAGTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029881.1-1925s1c1
Sequence:CCGGGATCTCATAACAACTTGAGTTCTCGAGAACTCAAGTTGTTATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029881.1-3439s1c1
Sequence:CCGGGCCTAAACATTTGTGAACATTCTCGAGAATGTTCACAAATGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029881.1-738s1c1
Sequence:CCGGGCTGGTGTCCATCATAGGAATCTCGAGATTCCTATGATGGACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029881.1-2112s1c1
Sequence:CCGGGCGTGTTAGAAATGGCTGGTTCTCGAGAACCAGCCATTTCTAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029881.1-1399s1c1
Sequence:CCGGCTACCTGTGATCAAGCTTAATCTCGAGATTAAGCTTGATCACAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029881.3-1959s1c1
Sequence:CCGGCGTTACTCCCAAGGAACAATTCTCGAGAATTGTTCCTTGGGAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029881
TMEM200A MISSION shRNA shRNA Plasmid DNA
transmembrane protein 200A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029881.1-1967s1c1
Sequence:CCGGGTAACAACTTGAAGCGAGGAACTCGAGTTCCTCGCTTCAAGTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029881.1-1925s1c1
Sequence:CCGGGATCTCATAACAACTTGAGTTCTCGAGAACTCAAGTTGTTATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029881.1-3439s1c1
Sequence:CCGGGCCTAAACATTTGTGAACATTCTCGAGAATGTTCACAAATGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029881.1-738s1c1
Sequence:CCGGGCTGGTGTCCATCATAGGAATCTCGAGATTCCTATGATGGACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029881.1-2112s1c1
Sequence:CCGGGCGTGTTAGAAATGGCTGGTTCTCGAGAACCAGCCATTTCTAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029881.1-1399s1c1
Sequence:CCGGCTACCTGTGATCAAGCTTAATCTCGAGATTAAGCTTGATCACAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029881.3-1959s1c1
Sequence:CCGGCGTTACTCCCAAGGAACAATTCTCGAGAATTGTTCCTTGGGAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029881
TMEM200A MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 200A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029881.1-1967s1c1
Sequence:CCGGGTAACAACTTGAAGCGAGGAACTCGAGTTCCTCGCTTCAAGTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029881.1-1925s1c1
Sequence:CCGGGATCTCATAACAACTTGAGTTCTCGAGAACTCAAGTTGTTATGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029881.1-3439s1c1
Sequence:CCGGGCCTAAACATTTGTGAACATTCTCGAGAATGTTCACAAATGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029881.1-738s1c1
Sequence:CCGGGCTGGTGTCCATCATAGGAATCTCGAGATTCCTATGATGGACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029881.1-2112s1c1
Sequence:CCGGGCGTGTTAGAAATGGCTGGTTCTCGAGAACCAGCCATTTCTAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029881.1-1399s1c1
Sequence:CCGGCTACCTGTGATCAAGCTTAATCTCGAGATTAAGCTTGATCACAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029881.3-1959s1c1
Sequence:CCGGCGTTACTCCCAAGGAACAATTCTCGAGAATTGTTCCTTGGGAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks