EMAIL THIS PAGE TO A FRIEND

TMEM200B

transmembrane protein 200B

Synonyms: TTMB
UniProtKB ID: Q69YZ2, Q6P2G8, Q6P2Q5
Gene ID:
Mouse(623230) transmembrane protein 200B
Rat(688757) transmembrane protein 200B
chicken(428217) transmembrane protein 200B
domestic cat(101089374) transmembrane protein 200B
dog(611990) transmembrane protein 200B
cow(100848266) transmembrane protein 200B
naked mole-rat(101722554) transmembrane protein 200B
domestic guinea pig(101787503) transmembrane protein 200B
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003682 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003682 Rosetta Predictions human pricing
XM_001068178 Rosetta Predictions rat pricing
XM_001475812 Rosetta Predictions mouse pricing
XM_887671 Rosetta Predictions mouse pricing
XR_004820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149684 predicted 1046
2 SASI_Hs01_00149685 predicted 1300
3 SASI_Hs01_00149686 predicted 1018
4 SASI_Hs01_00149687 predicted 447
5 SASI_Hs02_00304317 predicted 1085
6 SASI_Hs01_00149689 predicted 1315
7 SASI_Hs01_00149690 predicted 784
8 SASI_Hs01_00149691 predicted 813
9 SASI_Hs01_00149692 predicted 677
10 SASI_Hs01_00149693 predicted 1007
11 SASI_Hs01_00149688 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323705 predicted 2349
2 SASI_Rn02_00323706 predicted 319
3 SASI_Rn02_00323707 predicted 2360
4 SASI_Rn02_00323708 predicted 2374
5 SASI_Rn02_00323709 predicted 2357
6 SASI_Rn02_00323710 predicted 2358
7 SASI_Rn02_00323711 predicted 2370
8 SASI_Rn02_00323712 predicted 2354
9 SASI_Rn02_00323713 predicted 2372
10 SASI_Rn02_00323714 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00385112 predicted 1330
2 SASI_Mm02_00385113 predicted 1107
3 SASI_Mm02_00385114 predicted 1118
4 SASI_Mm02_00385115 predicted 720
5 SASI_Mm02_00385116 predicted 1465
6 SASI_Mm02_00385117 predicted 640
7 SASI_Mm02_00385118 predicted 1432
8 SASI_Mm02_00385119 predicted 1438
9 SASI_Mm02_00385120 predicted 1425
10 SASI_Mm02_00385121 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428518 predicted 1262
2 SASI_Mm02_00428519 predicted 1305
3 SASI_Mm01_00267719 predicted 553
4 SASI_Mm02_00428520 predicted 1216
5 SASI_Mm01_00267720 predicted 332
6 SASI_Mm02_00428521 predicted 846
7 SASI_Mm02_00428522 predicted 1330
8 SASI_Mm02_00428523 predicted 936
9 SASI_Mm02_00428524 predicted 1154
10 SASI_Mm01_00267722 predicted 680
11 SASI_Mm01_00267717 predicted 766
12 SASI_Mm01_00267718 predicted 484
13 SASI_Mm01_00267721 predicted 552
14 SASI_Mm01_00267723 predicted 321
15 SASI_Mm01_00267724 predicted 273
16 SASI_Mm01_00267725 predicted 662
17 SASI_Mm01_00267726 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_004820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212187 predicted 753
2 SASI_Mm01_00212188 predicted 466
3 SASI_Mm01_00212189 predicted 544
4 SASI_Mm01_00212190 predicted 330
5 SASI_Mm01_00212191 predicted 540
6 SASI_Mm01_00212192 predicted 676
7 SASI_Mm01_00212193 predicted 309
8 SASI_Mm01_00212194 predicted 260
9 SASI_Mm01_00212195 predicted 640
10 SASI_Mm01_00212196 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003682
VALIDATED
TMEM200B MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 200B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-248s21c1
Sequence:CCGGTACTGGTGGGTATGGGCATTGCTCGAGCAATGCCCATACCCACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-676s21c1
Sequence:CCGGCTGCGTTCAGAGCCCGCTAATCTCGAGATTAGCGGGCTCTGAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-1048s21c1
Sequence:CCGGAGGAGTCCCAACGTCTAATAGCTCGAGCTATTAGACGTTGGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-813s21c1
Sequence:CCGGTGGCTCCTGCATTGAACATTCCTCGAGGAATGTTCAATGCAGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-440s21c1
Sequence:CCGGTCGTGTTCATCTGCGCCAACACTCGAGTGTTGGCGCAGATGAACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003682.1-760s1c1
Sequence:CCGGCCAACACACTGCTGTATGAGACTCGAGTCTCATACAGCAGTGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003682.1-1117s1c1
Sequence:CCGGCTGGCTCCTGCATTGAACATTCTCGAGAATGTTCAATGCAGGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003682.1-2256s1c1
Sequence:CCGGGACTTGATTATTGCCTGTGTACTCGAGTACACAGGCAATAATCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003682
VALIDATED
TMEM200B MISSION shRNA shRNA Plasmid DNA
transmembrane protein 200B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-248s21c1
Sequence:CCGGTACTGGTGGGTATGGGCATTGCTCGAGCAATGCCCATACCCACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-676s21c1
Sequence:CCGGCTGCGTTCAGAGCCCGCTAATCTCGAGATTAGCGGGCTCTGAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-1048s21c1
Sequence:CCGGAGGAGTCCCAACGTCTAATAGCTCGAGCTATTAGACGTTGGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-813s21c1
Sequence:CCGGTGGCTCCTGCATTGAACATTCCTCGAGGAATGTTCAATGCAGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-440s21c1
Sequence:CCGGTCGTGTTCATCTGCGCCAACACTCGAGTGTTGGCGCAGATGAACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003682.1-760s1c1
Sequence:CCGGCCAACACACTGCTGTATGAGACTCGAGTCTCATACAGCAGTGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003682.1-1117s1c1
Sequence:CCGGCTGGCTCCTGCATTGAACATTCTCGAGAATGTTCAATGCAGGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003682.1-2256s1c1
Sequence:CCGGGACTTGATTATTGCCTGTGTACTCGAGTACACAGGCAATAATCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003682
VALIDATED
TMEM200B MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 200B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-248s21c1
Sequence:CCGGTACTGGTGGGTATGGGCATTGCTCGAGCAATGCCCATACCCACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-676s21c1
Sequence:CCGGCTGCGTTCAGAGCCCGCTAATCTCGAGATTAGCGGGCTCTGAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-1048s21c1
Sequence:CCGGAGGAGTCCCAACGTCTAATAGCTCGAGCTATTAGACGTTGGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-813s21c1
Sequence:CCGGTGGCTCCTGCATTGAACATTCCTCGAGGAATGTTCAATGCAGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001003682.2-440s21c1
Sequence:CCGGTCGTGTTCATCTGCGCCAACACTCGAGTGTTGGCGCAGATGAACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003682.1-760s1c1
Sequence:CCGGCCAACACACTGCTGTATGAGACTCGAGTCTCATACAGCAGTGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003682.1-1117s1c1
Sequence:CCGGCTGGCTCCTGCATTGAACATTCTCGAGAATGTTCAATGCAGGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003682.1-2256s1c1
Sequence:CCGGGACTTGATTATTGCCTGTGTACTCGAGTACACAGGCAATAATCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks