EMAIL THIS PAGE TO A FRIEND

TMEM200C

transmembrane protein 200C

Synonyms: TTMA
UniProtKB ID: A6NKL6
Gene ID:
Mouse(622645) transmembrane protein 200C
Rat(501201) transmembrane protein 200C
domestic guinea pig(100715385) transmembrane protein 200C
naked mole-rat(101716989) transmembrane protein 200C
cow(786855) transmembrane protein 200C
sheep(101102196) transmembrane protein 200C
domestic cat(101086427) transmembrane protein 200C
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080209 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220331 MISSION® esiRNA esiRNA targeting human TMEM200C human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080209 Rosetta Predictions human pricing
XM_928409 Rosetta Predictions human pricing
XM_001054710 Rosetta Predictions rat pricing
XM_576628 Rosetta Predictions rat pricing
XM_001480132 Rosetta Predictions mouse pricing
XM_887086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314361 predicted 333
2 SASI_Hs02_00314362 predicted 329
3 SASI_Hs02_00314363 predicted 370
4 SASI_Hs02_00314364 predicted 201
5 SASI_Hs02_00314365 predicted 472
6 SASI_Hs02_00314366 predicted 1681
7 SASI_Hs02_00314367 predicted 263
8 SASI_Hs02_00314368 predicted 247
9 SASI_Hs02_00314369 predicted 1690
10 SASI_Hs02_00314370 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273809 predicted 658
2 SASI_Hs01_00273810 predicted 879
3 SASI_Hs01_00273811 predicted 877
4 SASI_Hs01_00273812 predicted 598
5 SASI_Hs01_00273813 predicted 926
6 SASI_Hs01_00273814 predicted 757
7 SASI_Hs01_00273815 predicted 599
8 SASI_Hs01_00273816 predicted 715
9 SASI_Hs01_00273817 predicted 604
10 SASI_Hs01_00273818 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276909 predicted 1066
2 SASI_Rn02_00276910 predicted 612
3 SASI_Rn02_00276911 predicted 1541
4 SASI_Rn02_00276912 predicted 1459
5 SASI_Rn02_00276913 predicted 830
6 SASI_Rn02_00276914 predicted 616
7 SASI_Rn02_00276915 predicted 614
8 SASI_Rn02_00276916 predicted 1479
9 SASI_Rn02_00276917 predicted 823
10 SASI_Rn02_00276918 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405653 predicted 1370
2 SASI_Rn02_00405654 predicted 1447
3 SASI_Rn02_00405655 predicted 1451
4 SASI_Rn02_00405656 predicted 1365
5 SASI_Rn02_00405657 predicted 1536
6 SASI_Rn02_00405658 predicted 1455
7 SASI_Rn02_00405659 predicted 1438
8 SASI_Rn02_00405660 predicted 1448
9 SASI_Rn02_00405661 predicted 1440
10 SASI_Rn02_00405662 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00415253 predicted 474
2 SASI_Mm02_00415254 predicted 592
3 SASI_Mm02_00415255 predicted 624
4 SASI_Mm02_00415256 predicted 609
5 SASI_Mm02_00415257 predicted 2181
6 SASI_Mm02_00415258 predicted 1427
7 SASI_Mm02_00415259 predicted 1114
8 SASI_Mm02_00415260 predicted 632
9 SASI_Mm02_00415261 predicted 2092
10 SASI_Mm02_00415262 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428446 predicted 2159
2 SASI_Mm02_00428447 predicted 2185
3 SASI_Mm02_00428448 predicted 1399
4 SASI_Mm02_00428449 predicted 2189
5 SASI_Mm02_00428450 predicted 2176
6 SASI_Mm01_00238753 predicted 1427
7 SASI_Mm01_00238754 predicted 1450
8 SASI_Mm01_00238756 predicted 2085
9 SASI_Mm02_00428451 predicted 1432
10 SASI_Mm02_00428452 predicted 2072
11 SASI_Mm01_00238747 predicted 1263
12 SASI_Mm01_00238748 predicted 518
13 SASI_Mm01_00238749 predicted 636
14 SASI_Mm01_00238750 predicted 523
15 SASI_Mm01_00238751 predicted 660
16 SASI_Mm01_00238752 predicted 661
17 SASI_Mm01_00238755 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080209
TMEM200C MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 200C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-111s21c1
Sequence:CCGGATACCCAAGCGCAAGCGGAAACTCGAGTTTCCGCTTGCGCTTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-488s21c1
Sequence:CCGGGGGCTTCTTCTTCCGCATCTTCTCGAGAAGATGCGGAAGAAGAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-604s21c1
Sequence:CCGGACGAGAACCGGGACAAGAAGACTCGAGTCTTCTTGTCCCGGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-554s21c1
Sequence:CCGGCATCATGGGCATCGGCATCTTCTCGAGAAGATGCCGATGCCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-1693s21c1
Sequence:CCGGTGGACGCAGTAGCTGGTCAAACTCGAGTTTGACCAGCTACTGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080209
TMEM200C MISSION shRNA shRNA Plasmid DNA
transmembrane protein 200C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-111s21c1
Sequence:CCGGATACCCAAGCGCAAGCGGAAACTCGAGTTTCCGCTTGCGCTTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-488s21c1
Sequence:CCGGGGGCTTCTTCTTCCGCATCTTCTCGAGAAGATGCGGAAGAAGAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-604s21c1
Sequence:CCGGACGAGAACCGGGACAAGAAGACTCGAGTCTTCTTGTCCCGGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-554s21c1
Sequence:CCGGCATCATGGGCATCGGCATCTTCTCGAGAAGATGCCGATGCCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-1693s21c1
Sequence:CCGGTGGACGCAGTAGCTGGTCAAACTCGAGTTTGACCAGCTACTGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080209
TMEM200C MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 200C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-111s21c1
Sequence:CCGGATACCCAAGCGCAAGCGGAAACTCGAGTTTCCGCTTGCGCTTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-488s21c1
Sequence:CCGGGGGCTTCTTCTTCCGCATCTTCTCGAGAAGATGCGGAAGAAGAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-604s21c1
Sequence:CCGGACGAGAACCGGGACAAGAAGACTCGAGTCTTCTTGTCCCGGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-554s21c1
Sequence:CCGGCATCATGGGCATCGGCATCTTCTCGAGAAGATGCCGATGCCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080209.1-1693s21c1
Sequence:CCGGTGGACGCAGTAGCTGGTCAAACTCGAGTTTGACCAGCTACTGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks