EMAIL THIS PAGE TO A FRIEND

TMEM201

transmembrane protein 201

Synonyms: NET5
UniProtKB ID: Q5SNT2, B9EH90, Q5SNT3
Gene ID:
Mouse(230917) transmembrane protein 201
Rat(691426) transmembrane protein 201
Zebrafish(563814) transmembrane protein 201
Horse(100057527) transmembrane protein 201
domestic cat(101098555) transmembrane protein 201
dog(489643) transmembrane protein 201
chicken(419443) transmembrane protein 201
cow(507444) transmembrane protein 201
sheep(101113612) transmembrane protein 201
naked mole-rat(101714257) transmembrane protein 201
domestic guinea pig(100720883) transmembrane protein 201
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301097 ANTI-TMEM201 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081431 MISSION® esiRNA esiRNA human TMEM201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010866 Rosetta Predictions human pricing
XM_001078224 Rosetta Predictions rat pricing
NM_001025106 Rosetta Predictions mouse pricing
NM_177672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305821 predicted 1340
2 SASI_Hs01_00153902 predicted 1535
3 SASI_Hs02_00305822 predicted 347
4 SASI_Hs01_00153903 predicted 266
5 SASI_Hs01_00153904 predicted 1431
6 SASI_Hs01_00153905 predicted 1164
7 SASI_Hs01_00153906 predicted 1217
8 SASI_Hs01_00153907 predicted 822
9 SASI_Hs01_00153909 predicted 957
10 SASI_Hs01_00153910 predicted 1415
11 SASI_Hs01_00153901 predicted 1531
12 SASI_Hs01_00153908 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360017 predicted 1802
2 SASI_Rn02_00360018 predicted 1512
3 SASI_Rn02_00360019 predicted 2021
4 SASI_Rn02_00360020 predicted 1967
5 SASI_Rn02_00360021 predicted 1405
6 SASI_Rn02_00360022 predicted 1412
7 SASI_Rn02_00360023 predicted 1706
8 SASI_Rn02_00360024 predicted 1945
9 SASI_Rn02_00360025 predicted 1955
10 SASI_Rn02_00360026 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192617 predicted 665
2 SASI_Mm02_00287778 predicted 922
3 SASI_Mm01_00192620 predicted 516
4 SASI_Mm02_00287779 predicted 767
5 SASI_Mm01_00192622 predicted 688
6 SASI_Mm01_00192623 predicted 224
7 SASI_Mm02_00287780 predicted 905
8 SASI_Mm02_00287781 predicted 860
9 SASI_Mm02_00287782 predicted 779
10 SASI_Mm02_00287783 predicted 851
11 SASI_Mm01_00192616 predicted 345
12 SASI_Mm01_00192618 predicted 303
13 SASI_Mm01_00192619 predicted 558
14 SASI_Mm01_00192621 predicted 209
15 SASI_Mm01_00192624 predicted 321
16 SASI_Mm01_00192625 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034608 predicted 672
2 SASI_Mm02_00347981 predicted 924
3 SASI_Mm01_00034611 predicted 521
4 SASI_Mm02_00347982 predicted 760
5 SASI_Mm01_00034613 predicted 686
6 SASI_Mm01_00034614 predicted 227
7 SASI_Mm02_00347983 predicted 906
8 SASI_Mm02_00347984 predicted 868
9 SASI_Mm02_00347985 predicted 786
10 SASI_Mm02_00347986 predicted 853
11 SASI_Mm01_00034607 predicted 338
12 SASI_Mm01_00034609 predicted 305
13 SASI_Mm01_00034610 predicted 559
14 SASI_Mm01_00034612 predicted 214
15 SASI_Mm01_00034615 predicted 330
16 SASI_Mm01_00034616 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010866
VALIDATED
TMEM201 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 201
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-1064s21c1
Sequence:CCGGGGCTAGACACGCTCAAGTTCACTCGAGTGAACTTGAGCGTGTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-516s21c1
Sequence:CCGGAGCGGCTGTGGAGTACTACATCTCGAGATGTAGTACTCCACAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-3518s21c1
Sequence:CCGGGTGACCGTCCCTGAGACATAACTCGAGTTATGTCTCAGGGACGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-392s21c1
Sequence:CCGGACCAGACCACCAAGATCAAGCCTCGAGGCTTGATCTTGGTGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-134s21c1
Sequence:CCGGCAACGCACACGATGGTCAACTCTCGAGAGTTGACCATCGTGTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010866.1-2158s1c1
Sequence:CCGGCCTCAGTTTGCCATCTATGAACTCGAGTTCATAGATGGCAAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010866.1-3058s1c1
Sequence:CCGGGTGTTGACAGTGTGATGCTAACTCGAGTTAGCATCACACTGTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010866.1-2766s1c1
Sequence:CCGGGCTCAGCTTGTTGTTCTGTGTCTCGAGACACAGAACAACAAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010866
VALIDATED
TMEM201 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 201
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-1064s21c1
Sequence:CCGGGGCTAGACACGCTCAAGTTCACTCGAGTGAACTTGAGCGTGTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-516s21c1
Sequence:CCGGAGCGGCTGTGGAGTACTACATCTCGAGATGTAGTACTCCACAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-3518s21c1
Sequence:CCGGGTGACCGTCCCTGAGACATAACTCGAGTTATGTCTCAGGGACGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-392s21c1
Sequence:CCGGACCAGACCACCAAGATCAAGCCTCGAGGCTTGATCTTGGTGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-134s21c1
Sequence:CCGGCAACGCACACGATGGTCAACTCTCGAGAGTTGACCATCGTGTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010866.1-2158s1c1
Sequence:CCGGCCTCAGTTTGCCATCTATGAACTCGAGTTCATAGATGGCAAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010866.1-3058s1c1
Sequence:CCGGGTGTTGACAGTGTGATGCTAACTCGAGTTAGCATCACACTGTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010866.1-2766s1c1
Sequence:CCGGGCTCAGCTTGTTGTTCTGTGTCTCGAGACACAGAACAACAAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010866
VALIDATED
TMEM201 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 201
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-1064s21c1
Sequence:CCGGGGCTAGACACGCTCAAGTTCACTCGAGTGAACTTGAGCGTGTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-516s21c1
Sequence:CCGGAGCGGCTGTGGAGTACTACATCTCGAGATGTAGTACTCCACAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-3518s21c1
Sequence:CCGGGTGACCGTCCCTGAGACATAACTCGAGTTATGTCTCAGGGACGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-392s21c1
Sequence:CCGGACCAGACCACCAAGATCAAGCCTCGAGGCTTGATCTTGGTGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001010866.2-134s21c1
Sequence:CCGGCAACGCACACGATGGTCAACTCTCGAGAGTTGACCATCGTGTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010866.1-2158s1c1
Sequence:CCGGCCTCAGTTTGCCATCTATGAACTCGAGTTCATAGATGGCAAACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010866.1-3058s1c1
Sequence:CCGGGTGTTGACAGTGTGATGCTAACTCGAGTTAGCATCACACTGTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010866.1-2766s1c1
Sequence:CCGGGCTCAGCTTGTTGTTCTGTGTCTCGAGACACAGAACAACAAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177672
VALIDATED
TMEM201 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 201
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177672.2-406s1c1
Sequence:CCGGCCACCATACCACCAAGATCAACTCGAGTTGATCTTGGTGGTATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177672.2-2862s1c1
Sequence:CCGGGCTGACAATATGGTGTTAATTCTCGAGAATTAACACCATATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177672.2-239s1c1
Sequence:CCGGGAGCAGTACAATGGCTTTCAACTCGAGTTGAAAGCCATTGTACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177672.2-705s1c1
Sequence:CCGGGTGCCTTCTTGTTGTTCACTACTCGAGTAGTGAACAACAAGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177672.2-2312s1c1
Sequence:CCGGGCCGCTTGTCTGCTAACTTAACTCGAGTTAAGTTAGCAGACAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177672
VALIDATED
TMEM201 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 201
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177672.2-406s1c1
Sequence:CCGGCCACCATACCACCAAGATCAACTCGAGTTGATCTTGGTGGTATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177672.2-2862s1c1
Sequence:CCGGGCTGACAATATGGTGTTAATTCTCGAGAATTAACACCATATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177672.2-239s1c1
Sequence:CCGGGAGCAGTACAATGGCTTTCAACTCGAGTTGAAAGCCATTGTACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177672.2-705s1c1
Sequence:CCGGGTGCCTTCTTGTTGTTCACTACTCGAGTAGTGAACAACAAGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177672.2-2312s1c1
Sequence:CCGGGCCGCTTGTCTGCTAACTTAACTCGAGTTAAGTTAGCAGACAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177672
VALIDATED
TMEM201 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 201
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177672.2-406s1c1
Sequence:CCGGCCACCATACCACCAAGATCAACTCGAGTTGATCTTGGTGGTATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177672.2-2862s1c1
Sequence:CCGGGCTGACAATATGGTGTTAATTCTCGAGAATTAACACCATATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177672.2-239s1c1
Sequence:CCGGGAGCAGTACAATGGCTTTCAACTCGAGTTGAAAGCCATTGTACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177672.2-705s1c1
Sequence:CCGGGTGCCTTCTTGTTGTTCACTACTCGAGTAGTGAACAACAAGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177672.2-2312s1c1
Sequence:CCGGGCCGCTTGTCTGCTAACTTAACTCGAGTTAAGTTAGCAGACAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks