EMAIL THIS PAGE TO A FRIEND

TMEM202

transmembrane protein 202

UniProtKB ID: A6NGA9
Gene ID:
Mouse(73893) transmembrane protein 202
Rat(691306) transmembrane protein 202
cow(785001) transmembrane protein 202
sheep(101116319) transmembrane protein 202
domestic cat(101091373) transmembrane protein 202
dog(100686301) transmembrane protein 202
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080462 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080462 Rosetta Predictions human pricing
XM_294751 Rosetta Predictions human pricing
NM_001109636 Rosetta Predictions rat pricing
NM_178388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315066 predicted 224
2 SASI_Hs02_00315067 predicted 619
3 SASI_Hs02_00315068 predicted 567
4 SASI_Hs02_00315069 predicted 903
5 SASI_Hs02_00315070 predicted 198
6 SASI_Hs02_00315071 predicted 889
7 SASI_Hs02_00315072 predicted 915
8 SASI_Hs02_00315073 predicted 443
9 SASI_Hs02_00315074 predicted 829
10 SASI_Hs02_00315075 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_294751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254843 predicted 754
2 SASI_Hs01_00254844 predicted 794
3 SASI_Hs01_00254845 predicted 813
4 SASI_Hs01_00254846 predicted 789
5 SASI_Hs01_00254847 predicted 798
6 SASI_Hs01_00254848 predicted 788
7 SASI_Hs01_00254849 predicted 750
8 SASI_Hs01_00254850 predicted 754
9 SASI_Hs01_00254851 predicted 799
10 SASI_Hs01_00254852 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250292 predicted 889
2 SASI_Rn02_00250293 predicted 601
3 SASI_Rn02_00250294 predicted 658
4 SASI_Rn02_00250295 predicted 361
5 SASI_Rn02_00250296 predicted 849
6 SASI_Rn02_00250297 predicted 285
7 SASI_Rn02_00250298 predicted 780
8 SASI_Rn02_00250299 predicted 228
9 SASI_Rn02_00250300 predicted 878
10 SASI_Rn02_00250301 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182177 predicted 836
2 SASI_Mm01_00182178 predicted 268
3 SASI_Mm02_00348796 predicted 968
4 SASI_Mm01_00182179 predicted 883
5 SASI_Mm01_00182180 predicted 237
6 SASI_Mm01_00182181 predicted 978
7 SASI_Mm01_00182184 predicted 559
8 SASI_Mm01_00182185 predicted 579
9 SASI_Mm02_00348797 predicted 557
10 SASI_Mm01_00182186 predicted 940
11 SASI_Mm01_00182182 predicted 899
12 SASI_Mm01_00182183 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178388
TMEM202 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 202
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178388.2-570s1c1
Sequence:CCGGGCGCAGGTTGAATTATACACACTCGAGTGTGTATAATTCAACCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178388.2-571s1c1
Sequence:CCGGCGCAGGTTGAATTATACACAACTCGAGTTGTGTATAATTCAACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178388.2-950s21c1
Sequence:CCGGGATTGTGAACTTCGATGAAACCTCGAGGTTTCATCGAAGTTCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-636s21c1
Sequence:CCGGTGGTGCAGTGAGGTCTTATATCTCGAGATATAAGACCTCACTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-565s21c1
Sequence:CCGGTTCTGGCGCAGGTTGAATTATCTCGAGATAATTCAACCTGCGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-323s21c1
Sequence:CCGGAGCAGGACTCTGGACCTTATGCTCGAGCATAAGGTCCAGAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-370s21c1
Sequence:CCGGCACCCAAGCCACCCTATTATCCTCGAGGATAATAGGGTGGCTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178388
TMEM202 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 202
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178388.2-570s1c1
Sequence:CCGGGCGCAGGTTGAATTATACACACTCGAGTGTGTATAATTCAACCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178388.2-571s1c1
Sequence:CCGGCGCAGGTTGAATTATACACAACTCGAGTTGTGTATAATTCAACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178388.2-950s21c1
Sequence:CCGGGATTGTGAACTTCGATGAAACCTCGAGGTTTCATCGAAGTTCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-636s21c1
Sequence:CCGGTGGTGCAGTGAGGTCTTATATCTCGAGATATAAGACCTCACTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-565s21c1
Sequence:CCGGTTCTGGCGCAGGTTGAATTATCTCGAGATAATTCAACCTGCGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-323s21c1
Sequence:CCGGAGCAGGACTCTGGACCTTATGCTCGAGCATAAGGTCCAGAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-370s21c1
Sequence:CCGGCACCCAAGCCACCCTATTATCCTCGAGGATAATAGGGTGGCTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178388
TMEM202 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 202
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178388.2-570s1c1
Sequence:CCGGGCGCAGGTTGAATTATACACACTCGAGTGTGTATAATTCAACCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178388.2-571s1c1
Sequence:CCGGCGCAGGTTGAATTATACACAACTCGAGTTGTGTATAATTCAACCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178388.2-950s21c1
Sequence:CCGGGATTGTGAACTTCGATGAAACCTCGAGGTTTCATCGAAGTTCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-636s21c1
Sequence:CCGGTGGTGCAGTGAGGTCTTATATCTCGAGATATAAGACCTCACTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-565s21c1
Sequence:CCGGTTCTGGCGCAGGTTGAATTATCTCGAGATAATTCAACCTGCGCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-323s21c1
Sequence:CCGGAGCAGGACTCTGGACCTTATGCTCGAGCATAAGGTCCAGAGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178388.2-370s21c1
Sequence:CCGGCACCCAAGCCACCCTATTATCCTCGAGGATAATAGGGTGGCTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080462
TMEM202 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 202
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-275s21c1
Sequence:CCGGACGCAGGACTCTGGACCTTATCTCGAGATAAGGTCCAGAGTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-626s21c1
Sequence:CCGGTCTCTCTTCTCAACTACTTAACTCGAGTTAAGTAGTTGAGAAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-562s21c1
Sequence:CCGGGATCTCCTATGGACCTATTATCTCGAGATAATAGGTCCATAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-323s21c1
Sequence:CCGGCACCCAAGCCACCCTATTATCCTCGAGGATAATAGGGTGGCTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080462.1-869s21c1
Sequence:CCGGAGTTGGGAATGGTCACATAAACTCGAGTTTATGTGACCATTCCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080462
TMEM202 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 202
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-275s21c1
Sequence:CCGGACGCAGGACTCTGGACCTTATCTCGAGATAAGGTCCAGAGTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-626s21c1
Sequence:CCGGTCTCTCTTCTCAACTACTTAACTCGAGTTAAGTAGTTGAGAAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-562s21c1
Sequence:CCGGGATCTCCTATGGACCTATTATCTCGAGATAATAGGTCCATAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-323s21c1
Sequence:CCGGCACCCAAGCCACCCTATTATCCTCGAGGATAATAGGGTGGCTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080462.1-869s21c1
Sequence:CCGGAGTTGGGAATGGTCACATAAACTCGAGTTTATGTGACCATTCCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080462
TMEM202 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 202
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-275s21c1
Sequence:CCGGACGCAGGACTCTGGACCTTATCTCGAGATAAGGTCCAGAGTCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-626s21c1
Sequence:CCGGTCTCTCTTCTCAACTACTTAACTCGAGTTAAGTAGTTGAGAAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-562s21c1
Sequence:CCGGGATCTCCTATGGACCTATTATCTCGAGATAATAGGTCCATAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080462.1-323s21c1
Sequence:CCGGCACCCAAGCCACCCTATTATCCTCGAGGATAATAGGGTGGCTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080462.1-869s21c1
Sequence:CCGGAGTTGGGAATGGTCACATAAACTCGAGTTTATGTGACCATTCCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks