EMAIL THIS PAGE TO A FRIEND

TMEM203

transmembrane protein 203

Synonyms: HBEBP1
UniProtKB ID: Q969S6, Q6NW08
Gene ID:
Mouse(227615) transmembrane protein 203
Rat(311800) transmembrane protein 203
Zebrafish(436792) transmembrane protein 203
domestic cat(101083554) transmembrane protein 203
dog(491235) transmembrane protein 203
cow(100299402) transmembrane protein 203
sheep(101109868) transmembrane protein 203
domestic guinea pig(100729825) transmembrane protein 203
naked mole-rat(101718110) transmembrane protein 203
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053045 Rosetta Predictions human pricing
NM_001107819 Rosetta Predictions rat pricing
NM_177344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060810 predicted 968
2 SASI_Hs02_00361877 predicted 798
3 SASI_Hs01_00060812 predicted 490
4 SASI_Hs01_00060813 predicted 1097
5 SASI_Hs01_00060814 predicted 763
6 SASI_Hs01_00060815 predicted 1122
7 SASI_Hs01_00060816 predicted 1100
8 SASI_Hs02_00361878 predicted 577
9 SASI_Hs01_00060818 predicted 511
10 SASI_Hs02_00361879 predicted 1088
11 SASI_Hs01_00060809 predicted 937
12 SASI_Hs01_00060811 predicted 768
13 SASI_Hs01_00060817 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232585 predicted 477
2 SASI_Rn02_00232586 predicted 344
3 SASI_Rn02_00232587 predicted 547
4 SASI_Rn02_00232588 predicted 407
5 SASI_Rn02_00232589 predicted 282
6 SASI_Rn02_00232590 predicted 336
7 SASI_Rn02_00232591 predicted 471
8 SASI_Rn02_00232592 predicted 396
9 SASI_Rn02_00232593 predicted 602
10 SASI_Rn02_00232594 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090756 predicted 419
2 SASI_Mm01_00090757 predicted 576
3 SASI_Mm01_00090758 predicted 352
4 SASI_Mm01_00090759 predicted 297
5 SASI_Mm02_00347475 predicted 296
6 SASI_Mm01_00090761 predicted 578
7 SASI_Mm01_00090762 predicted 363
8 SASI_Mm02_00347476 predicted 369
9 SASI_Mm01_00090763 predicted 623
10 SASI_Mm01_00090764 predicted 419
11 SASI_Mm01_00090760 predicted 478
12 SASI_Mm01_00090765 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053045
VALIDATED
TMEM203 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 203
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053045.1-263s21c1
Sequence:CCGGCTTCGCCACCTTCGAGATCTTCTCGAGAAGATCTCGAAGGTGGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053045.1-392s21c1
Sequence:CCGGTGACGGGCTCAGCACCTACTTCTCGAGAAGTAGGTGCTGAGCCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053045.1-511s21c1
Sequence:CCGGTCTTCGAGATGCTGTTGTGCCCTCGAGGGCACAACAGCATCTCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168720    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053045.1-1354s1c1
Sequence:CCGGGCACACCTGAGACAGATTTAACTCGAGTTAAATCTGTCTCAGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053045.1-1364s1c1
Sequence:CCGGGACAGATTTAAGCCTCCCTAACTCGAGTTAGGGAGGCTTAAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053045.1-365s1c1
Sequence:CCGGGAACGTGTTCGTGCCTTTCTTCTCGAGAAGAAAGGCACGAACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-1099s1c1
Sequence:CCGGCTTCGGTAGATGCCTTTGTTACTCGAGTAACAAAGGCATCTACCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-783s1c1
Sequence:CCGGCAATCCTGTTTGAAATGGTTTCTCGAGAAACCATTTCAAACAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-1111s1c1
Sequence:CCGGCCTTTGTTAGATCTATCACATCTCGAGATGTGATAGATCTAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-782s1c1
Sequence:CCGGCCAATCCTGTTTGAAATGGTTCTCGAGAACCATTTCAAACAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053045
VALIDATED
TMEM203 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 203
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053045.1-263s21c1
Sequence:CCGGCTTCGCCACCTTCGAGATCTTCTCGAGAAGATCTCGAAGGTGGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053045.1-392s21c1
Sequence:CCGGTGACGGGCTCAGCACCTACTTCTCGAGAAGTAGGTGCTGAGCCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053045.1-511s21c1
Sequence:CCGGTCTTCGAGATGCTGTTGTGCCCTCGAGGGCACAACAGCATCTCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168720    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053045.1-1354s1c1
Sequence:CCGGGCACACCTGAGACAGATTTAACTCGAGTTAAATCTGTCTCAGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053045.1-1364s1c1
Sequence:CCGGGACAGATTTAAGCCTCCCTAACTCGAGTTAGGGAGGCTTAAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053045.1-365s1c1
Sequence:CCGGGAACGTGTTCGTGCCTTTCTTCTCGAGAAGAAAGGCACGAACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-1099s1c1
Sequence:CCGGCTTCGGTAGATGCCTTTGTTACTCGAGTAACAAAGGCATCTACCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-783s1c1
Sequence:CCGGCAATCCTGTTTGAAATGGTTTCTCGAGAAACCATTTCAAACAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-1111s1c1
Sequence:CCGGCCTTTGTTAGATCTATCACATCTCGAGATGTGATAGATCTAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-782s1c1
Sequence:CCGGCCAATCCTGTTTGAAATGGTTCTCGAGAACCATTTCAAACAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053045
VALIDATED
TMEM203 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 203
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053045.1-263s21c1
Sequence:CCGGCTTCGCCACCTTCGAGATCTTCTCGAGAAGATCTCGAAGGTGGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053045.1-392s21c1
Sequence:CCGGTGACGGGCTCAGCACCTACTTCTCGAGAAGTAGGTGCTGAGCCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053045.1-511s21c1
Sequence:CCGGTCTTCGAGATGCTGTTGTGCCCTCGAGGGCACAACAGCATCTCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168720    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053045.1-1354s1c1
Sequence:CCGGGCACACCTGAGACAGATTTAACTCGAGTTAAATCTGTCTCAGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053045.1-1364s1c1
Sequence:CCGGGACAGATTTAAGCCTCCCTAACTCGAGTTAGGGAGGCTTAAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053045.1-365s1c1
Sequence:CCGGGAACGTGTTCGTGCCTTTCTTCTCGAGAAGAAAGGCACGAACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-1099s1c1
Sequence:CCGGCTTCGGTAGATGCCTTTGTTACTCGAGTAACAAAGGCATCTACCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-783s1c1
Sequence:CCGGCAATCCTGTTTGAAATGGTTTCTCGAGAAACCATTTCAAACAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-1111s1c1
Sequence:CCGGCCTTTGTTAGATCTATCACATCTCGAGATGTGATAGATCTAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_053045.1-782s1c1
Sequence:CCGGCCAATCCTGTTTGAAATGGTTCTCGAGAACCATTTCAAACAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177344
VALIDATED
TMEM203 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 203
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177344.2-398s1c1
Sequence:CCGGCCTACTTCACCACCATCGTTTCTCGAGAAACGATGGTGGTGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177344.2-495s1c1
Sequence:CCGGCAAGTTTGTCTTTGAGATGTTCTCGAGAACATCTCAAAGACAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177344.2-264s1c1
Sequence:CCGGCTTTGAGATATTCGTGCACCTCTCGAGAGGTGCACGAATATCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177344.2-487s1c1
Sequence:CCGGCTTAGCCTCAAGTTTGTCTTTCTCGAGAAAGACAAACTTGAGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177344
VALIDATED
TMEM203 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 203
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177344.2-398s1c1
Sequence:CCGGCCTACTTCACCACCATCGTTTCTCGAGAAACGATGGTGGTGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177344.2-495s1c1
Sequence:CCGGCAAGTTTGTCTTTGAGATGTTCTCGAGAACATCTCAAAGACAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177344.2-264s1c1
Sequence:CCGGCTTTGAGATATTCGTGCACCTCTCGAGAGGTGCACGAATATCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177344.2-487s1c1
Sequence:CCGGCTTAGCCTCAAGTTTGTCTTTCTCGAGAAAGACAAACTTGAGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177344
VALIDATED
TMEM203 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 203
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177344.2-398s1c1
Sequence:CCGGCCTACTTCACCACCATCGTTTCTCGAGAAACGATGGTGGTGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177344.2-495s1c1
Sequence:CCGGCAAGTTTGTCTTTGAGATGTTCTCGAGAACATCTCAAAGACAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177344.2-264s1c1
Sequence:CCGGCTTTGAGATATTCGTGCACCTCTCGAGAGGTGCACGAATATCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177344.2-487s1c1
Sequence:CCGGCTTAGCCTCAAGTTTGTCTTTCTCGAGAAAGACAAACTTGAGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks