EMAIL THIS PAGE TO A FRIEND

TMEM204

transmembrane protein 204

Synonyms: C16orf30 CLP24
UniProtKB ID: Q9BSN7, D3DU76, Q3KRC1, Q9H7G5
Gene ID:
Human(79652) Summary: C16ORF30 plays a role in cell adhesion and cellular permeability at adherens junctions (Kearsey et al., 2004 [PubMed 15206924]
Mouse(407831) transmembrane protein 204
Rat(287129) transmembrane protein 204
naked mole-rat(101713255) transmembrane protein 204
domestic guinea pig(100725161) transmembrane protein 204
cow(615464) transmembrane protein 204
Zebrafish(751647) transmembrane protein 204
domestic cat(101085011) transmembrane protein 204
dog(100686333) transmembrane protein 204
chicken(416759) transmembrane protein 204
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024600 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042711 MISSION® esiRNA esiRNA targeting mouse Tmem204 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024600 Rosetta Predictions human pricing
NM_001009620 Rosetta Predictions rat pricing
NM_001001183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150475 predicted 502
2 SASI_Hs01_00150474 predicted 487
3 SASI_Hs02_00356951 predicted 678
4 SASI_Hs02_00356952 predicted 680
5 SASI_Hs01_00150476 predicted 592
6 SASI_Hs01_00150479 predicted 315
7 SASI_Hs02_00356953 predicted 315
8 SASI_Hs01_00150480 predicted 457
9 SASI_Hs02_00356954 predicted 459
10 SASI_Hs02_00356955 predicted 598
11 SASI_Hs01_00150472 predicted 1451
12 SASI_Hs01_00150473 predicted 1336
13 SASI_Hs01_00150477 predicted 1410
14 SASI_Hs01_00150478 predicted 1450
15 SASI_Hs01_00150481 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049886 predicted 1025
2 SASI_Rn01_00049888 predicted 875
3 SASI_Rn01_00049889 predicted 1089
4 SASI_Rn01_00049890 predicted 647
5 SASI_Rn01_00049891 predicted 815
6 SASI_Rn01_00049893 predicted 982
7 SASI_Rn01_00049894 predicted 781
8 SASI_Rn01_00049895 predicted 1013
9 SASI_Rn02_00199623 predicted 866
10 SASI_Rn02_00199624 predicted 994
11 SASI_Rn01_00049887 predicted 720
12 SASI_Rn01_00049892 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095664 predicted 1118
2 SASI_Mm01_00095665 predicted 1257
3 SASI_Mm02_00286093 predicted 1176
4 SASI_Mm01_00095666 predicted 1279
5 SASI_Mm01_00095667 predicted 893
6 SASI_Mm01_00095668 predicted 1380
7 SASI_Mm01_00095669 predicted 1259
8 SASI_Mm01_00095670 predicted 1257
9 SASI_Mm01_00095671 predicted 1387
10 SASI_Mm01_00095672 predicted 1035
11 SASI_Mm01_00095673 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024600
TMEM204 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 204
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024600.1-668s1c1
Sequence:CCGGCTCACTCATCCTCAACAACGTCTCGAGACGTTGTTGAGGATGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024600.1-1454s1c1
Sequence:CCGGGTTTACTGTTATGTCGGTCATCTCGAGATGACCGACATAACAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024600.1-1076s1c1
Sequence:CCGGGCTCGTGACTTTCTACAGAATCTCGAGATTCTGTAGAAAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024600.1-1668s1c1
Sequence:CCGGGCCATATCTTACACTTTGGTACTCGAGTACCAAAGTGTAAGATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024600.1-1664s1c1
Sequence:CCGGCCCAGCCATATCTTACACTTTCTCGAGAAAGTGTAAGATATGGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-705s21c1
Sequence:CCGGACTACGTGGAGTCACCATGCTCTCGAGAGCATGGTGACTCCACGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-322s21c1
Sequence:CCGGCAAACTGCAGTTCGACATGATCTCGAGATCATGTCGAACTGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-597s21c1
Sequence:CCGGCCATGCTCATCTGGAACATTCCTCGAGGAATGTTCCAGATGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-466s21c1
Sequence:CCGGTGCATTCCAACTGGCGAGTTTCTCGAGAAACTCGCCAGTTGGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024600.4-747s21c1
Sequence:CCGGCATCAACGCACACCTGCTATCCTCGAGGATAGCAGGTGTGCGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024600
TMEM204 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 204
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024600.1-668s1c1
Sequence:CCGGCTCACTCATCCTCAACAACGTCTCGAGACGTTGTTGAGGATGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024600.1-1454s1c1
Sequence:CCGGGTTTACTGTTATGTCGGTCATCTCGAGATGACCGACATAACAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024600.1-1076s1c1
Sequence:CCGGGCTCGTGACTTTCTACAGAATCTCGAGATTCTGTAGAAAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024600.1-1668s1c1
Sequence:CCGGGCCATATCTTACACTTTGGTACTCGAGTACCAAAGTGTAAGATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024600.1-1664s1c1
Sequence:CCGGCCCAGCCATATCTTACACTTTCTCGAGAAAGTGTAAGATATGGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-705s21c1
Sequence:CCGGACTACGTGGAGTCACCATGCTCTCGAGAGCATGGTGACTCCACGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-322s21c1
Sequence:CCGGCAAACTGCAGTTCGACATGATCTCGAGATCATGTCGAACTGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-597s21c1
Sequence:CCGGCCATGCTCATCTGGAACATTCCTCGAGGAATGTTCCAGATGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-466s21c1
Sequence:CCGGTGCATTCCAACTGGCGAGTTTCTCGAGAAACTCGCCAGTTGGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024600.4-747s21c1
Sequence:CCGGCATCAACGCACACCTGCTATCCTCGAGGATAGCAGGTGTGCGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024600
TMEM204 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 204
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024600.1-668s1c1
Sequence:CCGGCTCACTCATCCTCAACAACGTCTCGAGACGTTGTTGAGGATGAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024600.1-1454s1c1
Sequence:CCGGGTTTACTGTTATGTCGGTCATCTCGAGATGACCGACATAACAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024600.1-1076s1c1
Sequence:CCGGGCTCGTGACTTTCTACAGAATCTCGAGATTCTGTAGAAAGTCACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024600.1-1668s1c1
Sequence:CCGGGCCATATCTTACACTTTGGTACTCGAGTACCAAAGTGTAAGATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024600.1-1664s1c1
Sequence:CCGGCCCAGCCATATCTTACACTTTCTCGAGAAAGTGTAAGATATGGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-705s21c1
Sequence:CCGGACTACGTGGAGTCACCATGCTCTCGAGAGCATGGTGACTCCACGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-322s21c1
Sequence:CCGGCAAACTGCAGTTCGACATGATCTCGAGATCATGTCGAACTGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-597s21c1
Sequence:CCGGCCATGCTCATCTGGAACATTCCTCGAGGAATGTTCCAGATGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024600.4-466s21c1
Sequence:CCGGTGCATTCCAACTGGCGAGTTTCTCGAGAAACTCGCCAGTTGGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024600.4-747s21c1
Sequence:CCGGCATCAACGCACACCTGCTATCCTCGAGGATAGCAGGTGTGCGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001183
TMEM204 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 204
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1122s21c1
Sequence:CCGGCAATGCTCATCTGGAACATTCCTCGAGGAATGTTCCAGATGAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1047s21c1
Sequence:CCGGTTGGCCCTTACACCAACTTATCTCGAGATAAGTTGGTGTAAGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001183.1-1353s21c1
Sequence:CCGGTGAGTCCGGGCTACCTATATACTCGAGTATATAGGTAGCCCGGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1208s21c1
Sequence:CCGGTTTCGCCGTGGCTTAGATAATCTCGAGATTATCTAAGCCACGGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1246s21c1
Sequence:CCGGATGCTGAGAGCACCCTTATAGCTCGAGCTATAAGGGTGCTCTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001183
TMEM204 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 204
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1122s21c1
Sequence:CCGGCAATGCTCATCTGGAACATTCCTCGAGGAATGTTCCAGATGAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1047s21c1
Sequence:CCGGTTGGCCCTTACACCAACTTATCTCGAGATAAGTTGGTGTAAGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001183.1-1353s21c1
Sequence:CCGGTGAGTCCGGGCTACCTATATACTCGAGTATATAGGTAGCCCGGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1208s21c1
Sequence:CCGGTTTCGCCGTGGCTTAGATAATCTCGAGATTATCTAAGCCACGGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1246s21c1
Sequence:CCGGATGCTGAGAGCACCCTTATAGCTCGAGCTATAAGGGTGCTCTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001183
TMEM204 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 204
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1122s21c1
Sequence:CCGGCAATGCTCATCTGGAACATTCCTCGAGGAATGTTCCAGATGAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1047s21c1
Sequence:CCGGTTGGCCCTTACACCAACTTATCTCGAGATAAGTTGGTGTAAGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001183.1-1353s21c1
Sequence:CCGGTGAGTCCGGGCTACCTATATACTCGAGTATATAGGTAGCCCGGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1208s21c1
Sequence:CCGGTTTCGCCGTGGCTTAGATAATCTCGAGATTATCTAAGCCACGGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001183.1-1246s21c1
Sequence:CCGGATGCTGAGAGCACCCTTATAGCTCGAGCTATAAGGGTGCTCTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks