EMAIL THIS PAGE TO A FRIEND

TMEM205

transmembrane protein 205

Synonyms: UNQ501
UniProtKB ID: Q6UW68
Gene ID:
Mouse(235043) transmembrane protein 205
Rat(300441) transmembrane protein 205
Zebrafish(791204) transmembrane protein 205
dog(476707) transmembrane protein 205
domestic cat(101098038) transmembrane protein 205
cow(513699) transmembrane protein 205
sheep(101118016) transmembrane protein 205
domestic guinea pig(100720652) transmembrane protein 205
naked mole-rat(101708874) transmembrane protein 205
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198536 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198536 Rosetta Predictions human pricing
NM_001106804 Rosetta Predictions rat pricing
NM_178577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015415 predicted 709
2 SASI_Hs01_00015416 predicted 463
3 SASI_Hs01_00015418 predicted 447
4 SASI_Hs01_00015419 predicted 464
5 SASI_Hs01_00015420 predicted 438
6 SASI_Hs02_00372137 predicted 644
7 SASI_Hs02_00372138 predicted 632
8 SASI_Hs01_00015422 predicted 437
9 SASI_Hs01_00015423 predicted 682
10 SASI_Hs01_00015424 predicted 454
11 SASI_Hs01_00015417 predicted 524
12 SASI_Hs01_00015421 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222568 predicted 1113
2 SASI_Rn02_00222569 predicted 874
3 SASI_Rn02_00222570 predicted 1086
4 SASI_Rn02_00222571 predicted 1091
5 SASI_Rn02_00222572 predicted 1063
6 SASI_Rn02_00222573 predicted 862
7 SASI_Rn02_00222574 predicted 1095
8 SASI_Rn02_00222575 predicted 858
9 SASI_Rn02_00222576 predicted 1063
10 SASI_Rn02_00222577 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037203 predicted 355
2 SASI_Mm01_00037204 predicted 406
3 SASI_Mm01_00037206 predicted 418
4 SASI_Mm01_00037207 predicted 422
5 SASI_Mm01_00037208 predicted 405
6 SASI_Mm01_00037210 predicted 371
7 SASI_Mm01_00037211 predicted 473
8 SASI_Mm01_00037212 predicted 212
9 SASI_Mm02_00348900 predicted 507
10 SASI_Mm02_00348901 predicted 313
11 SASI_Mm01_00037205 predicted 199
12 SASI_Mm01_00037209 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178577
VALIDATED
TMEM205 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 205
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-216s21c1
Sequence:CCGGAGTCATCCACTTGCTGGTCTTCTCGAGAAGACCAGCAAGTGGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-633s21c1
Sequence:CCGGTGCTCTACGCCGGAAGTTCTACTCGAGTAGAACTTCCGGCGTAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-411s21c1
Sequence:CCGGCTGGATTCACCTCACACTGTGCTCGAGCACAGTGTGAGGTGAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-422s21c1
Sequence:CCGGTCACACTGTGGGAAGTCAGTCCTCGAGGACTGACTTCCCACAGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-480s21c1
Sequence:CCGGCATCAATGCTCGCTGGCTTGACTCGAGTCAAGCCAGCGAGCATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178577.3-333s1c1
Sequence:CCGGCAAGGTCTTCCCAGTCTATTTCTCGAGAAATAGACTGGGAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178577.3-332s1c1
Sequence:CCGGGCAAGGTCTTCCCAGTCTATTCTCGAGAATAGACTGGGAAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178577.3-374s1c1
Sequence:CCGGCCTTCATCAACCTCTGCATCTCTCGAGAGATGCAGAGGTTGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178577.3-267s1c1
Sequence:CCGGGACCTTTATCTCAGGCTTCCTCTCGAGAGGAAGCCTGAGATAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178577
VALIDATED
TMEM205 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 205
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-216s21c1
Sequence:CCGGAGTCATCCACTTGCTGGTCTTCTCGAGAAGACCAGCAAGTGGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-633s21c1
Sequence:CCGGTGCTCTACGCCGGAAGTTCTACTCGAGTAGAACTTCCGGCGTAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-411s21c1
Sequence:CCGGCTGGATTCACCTCACACTGTGCTCGAGCACAGTGTGAGGTGAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-422s21c1
Sequence:CCGGTCACACTGTGGGAAGTCAGTCCTCGAGGACTGACTTCCCACAGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-480s21c1
Sequence:CCGGCATCAATGCTCGCTGGCTTGACTCGAGTCAAGCCAGCGAGCATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178577.3-333s1c1
Sequence:CCGGCAAGGTCTTCCCAGTCTATTTCTCGAGAAATAGACTGGGAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178577.3-332s1c1
Sequence:CCGGGCAAGGTCTTCCCAGTCTATTCTCGAGAATAGACTGGGAAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178577.3-374s1c1
Sequence:CCGGCCTTCATCAACCTCTGCATCTCTCGAGAGATGCAGAGGTTGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178577.3-267s1c1
Sequence:CCGGGACCTTTATCTCAGGCTTCCTCTCGAGAGGAAGCCTGAGATAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178577
VALIDATED
TMEM205 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 205
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-216s21c1
Sequence:CCGGAGTCATCCACTTGCTGGTCTTCTCGAGAAGACCAGCAAGTGGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-633s21c1
Sequence:CCGGTGCTCTACGCCGGAAGTTCTACTCGAGTAGAACTTCCGGCGTAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-411s21c1
Sequence:CCGGCTGGATTCACCTCACACTGTGCTCGAGCACAGTGTGAGGTGAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-422s21c1
Sequence:CCGGTCACACTGTGGGAAGTCAGTCCTCGAGGACTGACTTCCCACAGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178577.4-480s21c1
Sequence:CCGGCATCAATGCTCGCTGGCTTGACTCGAGTCAAGCCAGCGAGCATTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178577.3-333s1c1
Sequence:CCGGCAAGGTCTTCCCAGTCTATTTCTCGAGAAATAGACTGGGAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178577.3-332s1c1
Sequence:CCGGGCAAGGTCTTCCCAGTCTATTCTCGAGAATAGACTGGGAAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178577.3-374s1c1
Sequence:CCGGCCTTCATCAACCTCTGCATCTCTCGAGAGATGCAGAGGTTGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178577.3-267s1c1
Sequence:CCGGGACCTTTATCTCAGGCTTCCTCTCGAGAGGAAGCCTGAGATAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198536
TMEM205 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 205
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-657s21c1
Sequence:CCGGCTTGGGCTCAGCTCACATTCTCTCGAGAGAATGTGAGCTGAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-455s21c1
Sequence:CCGGCTGATTAAGATGGTCCATCTACTCGAGTAGATGGACCATCTTAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-569s21c1
Sequence:CCGGCTAGTGCAGAGCAAACTCTTCCTCGAGGAAGAGTTTGCTCTGCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-610s21c1
Sequence:CCGGCATGGGCTGTGCCTTCATCAACTCGAGTTGATGAAGGCACAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-878s21c1
Sequence:CCGGAGTGCTCTCCGCCAGAATTTCCTCGAGGAAATTCTGGCGGAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198536.1-455s1c1
Sequence:CCGGCTGATTAAGATGGTCCATCTACTCGAGTAGATGGACCATCTTAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198536.1-463s1c1
Sequence:CCGGGATGGTCCATCTACTGGTCTTCTCGAGAAGACCAGTAGATGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198536.1-622s1c1
Sequence:CCGGCTTCATCAACCTCTGCATCTTCTCGAGAAGATGCAGAGGTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198536
TMEM205 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 205
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-657s21c1
Sequence:CCGGCTTGGGCTCAGCTCACATTCTCTCGAGAGAATGTGAGCTGAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-455s21c1
Sequence:CCGGCTGATTAAGATGGTCCATCTACTCGAGTAGATGGACCATCTTAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-569s21c1
Sequence:CCGGCTAGTGCAGAGCAAACTCTTCCTCGAGGAAGAGTTTGCTCTGCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-610s21c1
Sequence:CCGGCATGGGCTGTGCCTTCATCAACTCGAGTTGATGAAGGCACAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-878s21c1
Sequence:CCGGAGTGCTCTCCGCCAGAATTTCCTCGAGGAAATTCTGGCGGAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198536.1-455s1c1
Sequence:CCGGCTGATTAAGATGGTCCATCTACTCGAGTAGATGGACCATCTTAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198536.1-463s1c1
Sequence:CCGGGATGGTCCATCTACTGGTCTTCTCGAGAAGACCAGTAGATGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198536.1-622s1c1
Sequence:CCGGCTTCATCAACCTCTGCATCTTCTCGAGAAGATGCAGAGGTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198536
TMEM205 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 205
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-657s21c1
Sequence:CCGGCTTGGGCTCAGCTCACATTCTCTCGAGAGAATGTGAGCTGAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-455s21c1
Sequence:CCGGCTGATTAAGATGGTCCATCTACTCGAGTAGATGGACCATCTTAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-569s21c1
Sequence:CCGGCTAGTGCAGAGCAAACTCTTCCTCGAGGAAGAGTTTGCTCTGCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-610s21c1
Sequence:CCGGCATGGGCTGTGCCTTCATCAACTCGAGTTGATGAAGGCACAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198536.1-878s21c1
Sequence:CCGGAGTGCTCTCCGCCAGAATTTCCTCGAGGAAATTCTGGCGGAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198536.1-455s1c1
Sequence:CCGGCTGATTAAGATGGTCCATCTACTCGAGTAGATGGACCATCTTAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198536.1-463s1c1
Sequence:CCGGGATGGTCCATCTACTGGTCTTCTCGAGAAGACCAGTAGATGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198536.1-622s1c1
Sequence:CCGGCTTCATCAACCTCTGCATCTTCTCGAGAAGATGCAGAGGTTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks