EMAIL THIS PAGE TO A FRIEND

TMEM206

transmembrane protein 206

Synonyms: C1orf75 RP11-384C4.5
UniProtKB ID: Q9H813, B7Z4D6, Q6IA87, Q9NV85
Gene ID:
Mouse(66950) transmembrane protein 206
Rat(305070) transmembrane protein 206
naked mole-rat(101713249) transmembrane protein 206
domestic guinea pig(100734367) transmembrane protein 206
cow(616392) transmembrane protein 206
sheep(101116749) transmembrane protein 206
Zebrafish(393429) transmembrane protein 206
chicken(421371) transmembrane protein 206
domestic cat(101100175) transmembrane protein 206
dog(612794) transmembrane protein 206
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018252 Rosetta Predictions human pricing
NM_001007679 Rosetta Predictions rat pricing
NM_025864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032269 predicted 1124
2 SASI_Hs01_00032270 predicted 747
3 SASI_Hs01_00032271 predicted 877
4 SASI_Hs01_00032272 predicted 567
5 SASI_Hs01_00032273 predicted 946
6 SASI_Hs01_00032276 predicted 566
7 SASI_Hs01_00032277 predicted 463
8 SASI_Hs02_00351605 predicted 837
9 SASI_Hs01_00032278 predicted 481
10 SASI_Hs02_00351606 predicted 544
11 SASI_Hs01_00032274 predicted 735
12 SASI_Hs01_00032275 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076045 predicted 775
2 SASI_Rn01_00076046 predicted 1105
3 SASI_Rn01_00076047 predicted 892
4 SASI_Rn01_00076048 predicted 1006
5 SASI_Rn01_00076049 predicted 892
6 SASI_Rn01_00076051 predicted 1039
7 SASI_Rn01_00076052 predicted 388
8 SASI_Rn01_00076053 predicted 802
9 SASI_Rn01_00076054 predicted 199
10 SASI_Rn02_00198819 predicted 674
11 SASI_Rn01_00076050 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187856 predicted 791
2 SASI_Mm01_00187857 predicted 833
3 SASI_Mm01_00187858 predicted 741
4 SASI_Mm01_00187859 predicted 1402
5 SASI_Mm01_00187860 predicted 1268
6 SASI_Mm01_00187861 predicted 1346
7 SASI_Mm01_00187862 predicted 364
8 SASI_Mm01_00187863 predicted 460
9 SASI_Mm01_00187864 predicted 1049
10 SASI_Mm01_00187865 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018252
VALIDATED
TMEM206 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 206
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018252.1-420s1c1
Sequence:CCGGGAAACTCAAGCACCCTGTCATCTCGAGATGACAGGGTGCTTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018252.1-1023s1c1
Sequence:CCGGCCAAGATATAGTCACTGCCAACTCGAGTTGGCAGTGACTATATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018252.1-445s1c1
Sequence:CCGGGTGTCTTACAAGGAAGTGGATCTCGAGATCCACTTCCTTGTAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018252.1-1956s1c1
Sequence:CCGGGCTCAATCATCGGGCACAATTCTCGAGAATTGTGCCCGATGATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018252.1-705s1c1
Sequence:CCGGGAACAAGAGTAGTGAGGACTTCTCGAGAAGTCCTCACTACTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018252.1-702s1c1
Sequence:CCGGCCTGAACAAGAGTAGTGAGGACTCGAGTCCTCACTACTCTTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018252.1-1247s1c1
Sequence:CCGGCCACTTTGTAAACGGAGCTATCTCGAGATAGCTCCGTTTACAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018252.2-1220s21c1
Sequence:CCGGGAAGTCACCTCGCGTTGTTTACTCGAGTAAACAACGCGAGGTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018252.2-450s21c1
Sequence:CCGGGAAACTCAAGCACCCTGTCATCTCGAGATGACAGGGTGCTTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018252.2-1277s21c1
Sequence:CCGGCCACTTTGTAAACGGAGCTATCTCGAGATAGCTCCGTTTACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018252.2-735s21c1
Sequence:CCGGGAACAAGAGTAGTGAGGACTTCTCGAGAAGTCCTCACTACTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018252.2-1134s21c1
Sequence:CCGGGTTTGCCAAACTGAGTATAAACTCGAGTTTATACTCAGTTTGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018252
VALIDATED
TMEM206 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 206
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018252.1-420s1c1
Sequence:CCGGGAAACTCAAGCACCCTGTCATCTCGAGATGACAGGGTGCTTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018252.1-1023s1c1
Sequence:CCGGCCAAGATATAGTCACTGCCAACTCGAGTTGGCAGTGACTATATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018252.1-445s1c1
Sequence:CCGGGTGTCTTACAAGGAAGTGGATCTCGAGATCCACTTCCTTGTAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018252.1-1956s1c1
Sequence:CCGGGCTCAATCATCGGGCACAATTCTCGAGAATTGTGCCCGATGATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018252.1-705s1c1
Sequence:CCGGGAACAAGAGTAGTGAGGACTTCTCGAGAAGTCCTCACTACTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018252.1-702s1c1
Sequence:CCGGCCTGAACAAGAGTAGTGAGGACTCGAGTCCTCACTACTCTTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018252.1-1247s1c1
Sequence:CCGGCCACTTTGTAAACGGAGCTATCTCGAGATAGCTCCGTTTACAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018252.2-1220s21c1
Sequence:CCGGGAAGTCACCTCGCGTTGTTTACTCGAGTAAACAACGCGAGGTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018252.2-450s21c1
Sequence:CCGGGAAACTCAAGCACCCTGTCATCTCGAGATGACAGGGTGCTTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018252.2-1277s21c1
Sequence:CCGGCCACTTTGTAAACGGAGCTATCTCGAGATAGCTCCGTTTACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018252.2-735s21c1
Sequence:CCGGGAACAAGAGTAGTGAGGACTTCTCGAGAAGTCCTCACTACTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018252.2-1134s21c1
Sequence:CCGGGTTTGCCAAACTGAGTATAAACTCGAGTTTATACTCAGTTTGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018252
VALIDATED
TMEM206 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 206
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018252.1-420s1c1
Sequence:CCGGGAAACTCAAGCACCCTGTCATCTCGAGATGACAGGGTGCTTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018252.1-1023s1c1
Sequence:CCGGCCAAGATATAGTCACTGCCAACTCGAGTTGGCAGTGACTATATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018252.1-445s1c1
Sequence:CCGGGTGTCTTACAAGGAAGTGGATCTCGAGATCCACTTCCTTGTAAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018252.1-1956s1c1
Sequence:CCGGGCTCAATCATCGGGCACAATTCTCGAGAATTGTGCCCGATGATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018252.1-705s1c1
Sequence:CCGGGAACAAGAGTAGTGAGGACTTCTCGAGAAGTCCTCACTACTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018252.1-702s1c1
Sequence:CCGGCCTGAACAAGAGTAGTGAGGACTCGAGTCCTCACTACTCTTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018252.1-1247s1c1
Sequence:CCGGCCACTTTGTAAACGGAGCTATCTCGAGATAGCTCCGTTTACAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018252.2-1220s21c1
Sequence:CCGGGAAGTCACCTCGCGTTGTTTACTCGAGTAAACAACGCGAGGTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018252.2-450s21c1
Sequence:CCGGGAAACTCAAGCACCCTGTCATCTCGAGATGACAGGGTGCTTGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018252.2-1277s21c1
Sequence:CCGGCCACTTTGTAAACGGAGCTATCTCGAGATAGCTCCGTTTACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018252.2-735s21c1
Sequence:CCGGGAACAAGAGTAGTGAGGACTTCTCGAGAAGTCCTCACTACTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018252.2-1134s21c1
Sequence:CCGGGTTTGCCAAACTGAGTATAAACTCGAGTTTATACTCAGTTTGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025864
VALIDATED
TMEM206 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 206
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-963s1c1
Sequence:CCGGCAGGACATAATCACAGCCAATCTCGAGATTGGCTGTGATTATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-523s1c1
Sequence:CCGGGCACCACTCAGAGGATCAATTCTCGAGAATTGATCCTCTGAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-1261s1c1
Sequence:CCGGCCAGTGAATAACCTGAAACTTCTCGAGAAGTTTCAGGTTATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-837s1c1
Sequence:CCGGGAAGCTGTTGAGTTCCGTCAACTCGAGTTGACGGAACTCAACAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025864.2-384s1c1
Sequence:CCGGGTGTCTTACAAGGAGGTGGATCTCGAGATCCACCTCCTTGTAAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-836s21c1
Sequence:CCGGGAAGCTGTTGAGTTCCGTCAACTCGAGTTGACGGAACTCAACAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-860s21c1
Sequence:CCGGACCAGCGTGGTTAACTATATTCTCGAGAATATAGTTAACCACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-1044s21c1
Sequence:CCGGTTGCCAAACTAAGCGTGAAATCTCGAGATTTCACGCTTAGTTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-1260s21c1
Sequence:CCGGCCAGTGAATAACCTGAAACTTCTCGAGAAGTTTCAGGTTATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-522s21c1
Sequence:CCGGGCACCACTCAGAGGATCAATTCTCGAGAATTGATCCTCTGAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025864
VALIDATED
TMEM206 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 206
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-963s1c1
Sequence:CCGGCAGGACATAATCACAGCCAATCTCGAGATTGGCTGTGATTATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-523s1c1
Sequence:CCGGGCACCACTCAGAGGATCAATTCTCGAGAATTGATCCTCTGAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-1261s1c1
Sequence:CCGGCCAGTGAATAACCTGAAACTTCTCGAGAAGTTTCAGGTTATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-837s1c1
Sequence:CCGGGAAGCTGTTGAGTTCCGTCAACTCGAGTTGACGGAACTCAACAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025864.2-384s1c1
Sequence:CCGGGTGTCTTACAAGGAGGTGGATCTCGAGATCCACCTCCTTGTAAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-836s21c1
Sequence:CCGGGAAGCTGTTGAGTTCCGTCAACTCGAGTTGACGGAACTCAACAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-860s21c1
Sequence:CCGGACCAGCGTGGTTAACTATATTCTCGAGAATATAGTTAACCACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-1044s21c1
Sequence:CCGGTTGCCAAACTAAGCGTGAAATCTCGAGATTTCACGCTTAGTTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-1260s21c1
Sequence:CCGGCCAGTGAATAACCTGAAACTTCTCGAGAAGTTTCAGGTTATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-522s21c1
Sequence:CCGGGCACCACTCAGAGGATCAATTCTCGAGAATTGATCCTCTGAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025864
VALIDATED
TMEM206 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 206
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-963s1c1
Sequence:CCGGCAGGACATAATCACAGCCAATCTCGAGATTGGCTGTGATTATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-523s1c1
Sequence:CCGGGCACCACTCAGAGGATCAATTCTCGAGAATTGATCCTCTGAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-1261s1c1
Sequence:CCGGCCAGTGAATAACCTGAAACTTCTCGAGAAGTTTCAGGTTATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025864.2-837s1c1
Sequence:CCGGGAAGCTGTTGAGTTCCGTCAACTCGAGTTGACGGAACTCAACAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025864.2-384s1c1
Sequence:CCGGGTGTCTTACAAGGAGGTGGATCTCGAGATCCACCTCCTTGTAAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-836s21c1
Sequence:CCGGGAAGCTGTTGAGTTCCGTCAACTCGAGTTGACGGAACTCAACAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-860s21c1
Sequence:CCGGACCAGCGTGGTTAACTATATTCTCGAGAATATAGTTAACCACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-1044s21c1
Sequence:CCGGTTGCCAAACTAAGCGTGAAATCTCGAGATTTCACGCTTAGTTTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-1260s21c1
Sequence:CCGGCCAGTGAATAACCTGAAACTTCTCGAGAAGTTTCAGGTTATTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025864.3-522s21c1
Sequence:CCGGGCACCACTCAGAGGATCAATTCTCGAGAATTGATCCTCTGAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks