EMAIL THIS PAGE TO A FRIEND

TMEM207

transmembrane protein 207

Synonyms: UNQ846
UniProtKB ID: Q6UWW9
Gene ID:
Mouse(100043057) transmembrane protein 207
Rat(100360091) transmembrane protein 207
chicken(424909) transmembrane protein 207
domestic cat(101081244) transmembrane protein 207
dog(608224) transmembrane protein 207
cow(100295666) transmembrane protein 207
sheep(101105130) transmembrane protein 207
domestic guinea pig(100714150) transmembrane protein 207
naked mole-rat(101711335) transmembrane protein 207
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014332 Anti-TMEM207 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_059548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_059548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_059548 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016711 MISSION® esiRNA esiRNA targeting human TMEM207 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207316 Rosetta Predictions human pricing
XM_001479418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217467 predicted 398
2 SASI_Hs01_00217468 predicted 556
3 SASI_Hs01_00217469 predicted 203
4 SASI_Hs01_00217471 predicted 595
5 SASI_Hs02_00373857 predicted 421
6 SASI_Hs01_00217472 predicted 477
7 SASI_Hs01_00217473 predicted 435
8 SASI_Hs01_00217474 predicted 469
9 SASI_Hs01_00217475 predicted 560
10 SASI_Hs02_00373858 predicted 380
11 SASI_Hs01_00217466 predicted 385
12 SASI_Hs01_00217470 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00409790 predicted 341
2 SASI_Mm02_00409791 predicted 245
3 SASI_Mm02_00409792 predicted 314
4 SASI_Mm02_00409793 predicted 321
5 SASI_Mm02_00409794 predicted 329
6 SASI_Mm02_00409795 predicted 289
7 SASI_Mm02_00409796 predicted 331
8 SASI_Mm02_00409797 predicted 338
9 SASI_Mm02_00409798 predicted 283
10 SASI_Mm02_00409799 predicted 297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101640
TMEM207 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 207
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-336s21c1
Sequence:CCGGTGGAGACTTGGATCCTGTTTACTCGAGTAAACAGGATCCAAGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101640.1-495s21c1
Sequence:CCGGTCCAGATGCAGCAGCTATATTCTCGAGAATATAGCTGCTGCATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-445s21c1
Sequence:CCGGTTAGGTCCTCCACCGCCATATCTCGAGATATGGCGGTGGAGGACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-109s21c1
Sequence:CCGGTGCCTGTGTTTGCCACTATTCCTCGAGGAATAGTGGCAAACACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-192s21c1
Sequence:CCGGATATCCTGATGGCTGGTATATCTCGAGATATACCAGCCATCAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101640
TMEM207 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 207
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-336s21c1
Sequence:CCGGTGGAGACTTGGATCCTGTTTACTCGAGTAAACAGGATCCAAGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101640.1-495s21c1
Sequence:CCGGTCCAGATGCAGCAGCTATATTCTCGAGAATATAGCTGCTGCATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-445s21c1
Sequence:CCGGTTAGGTCCTCCACCGCCATATCTCGAGATATGGCGGTGGAGGACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-109s21c1
Sequence:CCGGTGCCTGTGTTTGCCACTATTCCTCGAGGAATAGTGGCAAACACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-192s21c1
Sequence:CCGGATATCCTGATGGCTGGTATATCTCGAGATATACCAGCCATCAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101640
TMEM207 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 207
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-336s21c1
Sequence:CCGGTGGAGACTTGGATCCTGTTTACTCGAGTAAACAGGATCCAAGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101640.1-495s21c1
Sequence:CCGGTCCAGATGCAGCAGCTATATTCTCGAGAATATAGCTGCTGCATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-445s21c1
Sequence:CCGGTTAGGTCCTCCACCGCCATATCTCGAGATATGGCGGTGGAGGACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-109s21c1
Sequence:CCGGTGCCTGTGTTTGCCACTATTCCTCGAGGAATAGTGGCAAACACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101640.1-192s21c1
Sequence:CCGGATATCCTGATGGCTGGTATATCTCGAGATATACCAGCCATCAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_059548
TMEM207 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 207
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059548.3-1268s1c1
Sequence:CCGGCCTTCGGCATAGGTATCTGTTCTCGAGAACAGATACCTATGCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059548.3-425s1c1
Sequence:CCGGCCTGACCTATATCCTGTTCCTCTCGAGAGGAACAGGATATAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059548.3-939s1c1
Sequence:CCGGCCAGAACCAGAAAGATAGTATCTCGAGATACTATCTTTCTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059548.3-1236s1c1
Sequence:CCGGGCTTGGCATTTATTGCAGCATCTCGAGATGCTGCAATAAATGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059548.3-103s1c1
Sequence:CCGGGATCTCAACGATAGGGATCTTCTCGAGAAGATCCCTATCGTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_059548
TMEM207 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 207
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059548.3-1268s1c1
Sequence:CCGGCCTTCGGCATAGGTATCTGTTCTCGAGAACAGATACCTATGCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059548.3-425s1c1
Sequence:CCGGCCTGACCTATATCCTGTTCCTCTCGAGAGGAACAGGATATAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059548.3-939s1c1
Sequence:CCGGCCAGAACCAGAAAGATAGTATCTCGAGATACTATCTTTCTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059548.3-1236s1c1
Sequence:CCGGGCTTGGCATTTATTGCAGCATCTCGAGATGCTGCAATAAATGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059548.3-103s1c1
Sequence:CCGGGATCTCAACGATAGGGATCTTCTCGAGAAGATCCCTATCGTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_059548
TMEM207 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 207
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059548.3-1268s1c1
Sequence:CCGGCCTTCGGCATAGGTATCTGTTCTCGAGAACAGATACCTATGCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059548.3-425s1c1
Sequence:CCGGCCTGACCTATATCCTGTTCCTCTCGAGAGGAACAGGATATAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059548.3-939s1c1
Sequence:CCGGCCAGAACCAGAAAGATAGTATCTCGAGATACTATCTTTCTGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_059548.3-1236s1c1
Sequence:CCGGGCTTGGCATTTATTGCAGCATCTCGAGATGCTGCAATAAATGCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059548.3-103s1c1
Sequence:CCGGGATCTCAACGATAGGGATCTTCTCGAGAAGATCCCTATCGTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks