EMAIL THIS PAGE TO A FRIEND

TMEM208

transmembrane protein 208

UniProtKB ID: Q9BTX3, Q05CT0, Q96D25, Q9NZZ7
Gene ID:
Mouse(66320) transmembrane protein 208
Rat(291963) transmembrane protein 208
naked mole-rat(101716340) transmembrane protein 208
domestic guinea pig(100732396) transmembrane protein 208
cow(507222) transmembrane protein 208
sheep(101112754) transmembrane protein 208
chicken(100857564) transmembrane protein 208
domestic cat(101099167) transmembrane protein 208
dog(489761) transmembrane protein 208
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014187 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014187 Rosetta Predictions human pricing
NM_001106179 Rosetta Predictions rat pricing
NM_025486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179109 predicted 402
2 SASI_Hs01_00179105 predicted 460
3 SASI_Hs01_00179106 predicted 207
4 SASI_Hs02_00345219 predicted 393
5 SASI_Hs01_00179108 predicted 214
6 SASI_Hs01_00179110 predicted 505
7 SASI_Hs01_00179111 predicted 275
8 SASI_Hs01_00179112 predicted 400
9 SASI_Hs01_00179113 predicted 458
10 SASI_Hs01_00179114 predicted 274
11 SASI_Hs01_00179107 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216408 predicted 418
2 SASI_Rn02_00216409 predicted 520
3 SASI_Rn02_00216410 predicted 517
4 SASI_Rn02_00216411 predicted 321
5 SASI_Rn02_00216412 predicted 246
6 SASI_Rn02_00216413 predicted 422
7 SASI_Rn02_00216414 predicted 436
8 SASI_Rn02_00216415 predicted 526
9 SASI_Rn02_00216416 predicted 482
10 SASI_Rn02_00216417 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199785 predicted 196
2 SASI_Mm02_00328357 predicted 242
3 SASI_Mm01_00199786 predicted 253
4 SASI_Mm01_00199787 predicted 438
5 SASI_Mm02_00328358 predicted 399
6 SASI_Mm01_00199788 predicted 319
7 SASI_Mm01_00199789 predicted 197
8 SASI_Mm01_00199791 predicted 437
9 SASI_Mm01_00199792 predicted 383
10 SASI_Mm01_00199793 predicted 286
11 SASI_Mm01_00199790 predicted 200
12 SASI_Mm01_00199794 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014187
VALIDATED
TMEM208 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 208
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-160s1c1
Sequence:CCGGGAGAACAGAGAGACTCTGAAGCTCGAGCTTCAGAGTCTCTCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014187.1-162s1c1
Sequence:CCGGGAACAGAGAGACTCTGAAGTTCTCGAGAACTTCAGAGTCTCTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-213s1c1
Sequence:CCGGCATTTACTGCCTTGTGACGTTCTCGAGAACGTCACAAGGCAGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-165s1c1
Sequence:CCGGCAGAGAGACTCTGAAGTTCTACTCGAGTAGAACTTCAGAGTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-432s1c1
Sequence:CCGGCCTTAAGGATGTGATCCTACTCTCGAGAGTAGGATCACATCCTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-177s1c1
Sequence:CCGGGAAGTTCTACCTGCGGATCATCTCGAGATGATCCGCAGGTAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014187.3-211s21c1
Sequence:CCGGCATTTACTGCCTTGTGACGTTCTCGAGAACGTCACAAGGCAGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014187.3-175s21c1
Sequence:CCGGGAAGTTCTACCTGCGGATCATCTCGAGATGATCCGCAGGTAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014187.3-409s21c1
Sequence:CCGGCCTTAAGGATGTGATCCTACTCTCGAGAGTAGGATCACATCCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014187.3-163s21c1
Sequence:CCGGCAGAGAGACTCTGAAGTTCTACTCGAGTAGAACTTCAGAGTCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014187
VALIDATED
TMEM208 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 208
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-160s1c1
Sequence:CCGGGAGAACAGAGAGACTCTGAAGCTCGAGCTTCAGAGTCTCTCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014187.1-162s1c1
Sequence:CCGGGAACAGAGAGACTCTGAAGTTCTCGAGAACTTCAGAGTCTCTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-213s1c1
Sequence:CCGGCATTTACTGCCTTGTGACGTTCTCGAGAACGTCACAAGGCAGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-165s1c1
Sequence:CCGGCAGAGAGACTCTGAAGTTCTACTCGAGTAGAACTTCAGAGTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-432s1c1
Sequence:CCGGCCTTAAGGATGTGATCCTACTCTCGAGAGTAGGATCACATCCTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-177s1c1
Sequence:CCGGGAAGTTCTACCTGCGGATCATCTCGAGATGATCCGCAGGTAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014187.3-211s21c1
Sequence:CCGGCATTTACTGCCTTGTGACGTTCTCGAGAACGTCACAAGGCAGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014187.3-175s21c1
Sequence:CCGGGAAGTTCTACCTGCGGATCATCTCGAGATGATCCGCAGGTAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014187.3-409s21c1
Sequence:CCGGCCTTAAGGATGTGATCCTACTCTCGAGAGTAGGATCACATCCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014187.3-163s21c1
Sequence:CCGGCAGAGAGACTCTGAAGTTCTACTCGAGTAGAACTTCAGAGTCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014187
VALIDATED
TMEM208 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 208
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-160s1c1
Sequence:CCGGGAGAACAGAGAGACTCTGAAGCTCGAGCTTCAGAGTCTCTCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014187.1-162s1c1
Sequence:CCGGGAACAGAGAGACTCTGAAGTTCTCGAGAACTTCAGAGTCTCTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-213s1c1
Sequence:CCGGCATTTACTGCCTTGTGACGTTCTCGAGAACGTCACAAGGCAGTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-165s1c1
Sequence:CCGGCAGAGAGACTCTGAAGTTCTACTCGAGTAGAACTTCAGAGTCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-432s1c1
Sequence:CCGGCCTTAAGGATGTGATCCTACTCTCGAGAGTAGGATCACATCCTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014187.1-177s1c1
Sequence:CCGGGAAGTTCTACCTGCGGATCATCTCGAGATGATCCGCAGGTAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014187.3-211s21c1
Sequence:CCGGCATTTACTGCCTTGTGACGTTCTCGAGAACGTCACAAGGCAGTAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014187.3-175s21c1
Sequence:CCGGGAAGTTCTACCTGCGGATCATCTCGAGATGATCCGCAGGTAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014187.3-409s21c1
Sequence:CCGGCCTTAAGGATGTGATCCTACTCTCGAGAGTAGGATCACATCCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014187.3-163s21c1
Sequence:CCGGCAGAGAGACTCTGAAGTTCTACTCGAGTAGAACTTCAGAGTCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025486
VALIDATED
TMEM208 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 208
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025486.1-555s1c1
Sequence:CCGGGAGCTCAATGAGAAACGACAACTCGAGTTGTCGTTTCTCATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-211s1c1
Sequence:CCGGCCTTGGTCTTCTTCTATTCCTCTCGAGAGGAATAGAAGAAGACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025486.1-116s1c1
Sequence:CCGGCAGAGGGAAGAAACAGATATTCTCGAGAATATCTGTTTCTTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-143s1c1
Sequence:CCGGGAACAAAGAAACTCTCAAGTTCTCGAGAACTTGAGAGTTTCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-549s1c1
Sequence:CCGGGCACCAGAGCTCAATGAGAAACTCGAGTTTCTCATTGAGCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-407s1c1
Sequence:CCGGCCTACTGACAGCCATTGTTCACTCGAGTGAACAATGGCTGTCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-211s21c1
Sequence:CCGGCCTTGGTCTTCTTCTATTCCTCTCGAGAGGAATAGAAGAAGACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-116s21c1
Sequence:CCGGCAGAGGGAAGAAACAGATATTCTCGAGAATATCTGTTTCTTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-549s21c1
Sequence:CCGGGCACCAGAGCTCAATGAGAAACTCGAGTTTCTCATTGAGCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-143s21c1
Sequence:CCGGGAACAAAGAAACTCTCAAGTTCTCGAGAACTTGAGAGTTTCTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025486
VALIDATED
TMEM208 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 208
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025486.1-555s1c1
Sequence:CCGGGAGCTCAATGAGAAACGACAACTCGAGTTGTCGTTTCTCATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-211s1c1
Sequence:CCGGCCTTGGTCTTCTTCTATTCCTCTCGAGAGGAATAGAAGAAGACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025486.1-116s1c1
Sequence:CCGGCAGAGGGAAGAAACAGATATTCTCGAGAATATCTGTTTCTTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-143s1c1
Sequence:CCGGGAACAAAGAAACTCTCAAGTTCTCGAGAACTTGAGAGTTTCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-549s1c1
Sequence:CCGGGCACCAGAGCTCAATGAGAAACTCGAGTTTCTCATTGAGCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-407s1c1
Sequence:CCGGCCTACTGACAGCCATTGTTCACTCGAGTGAACAATGGCTGTCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-211s21c1
Sequence:CCGGCCTTGGTCTTCTTCTATTCCTCTCGAGAGGAATAGAAGAAGACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-116s21c1
Sequence:CCGGCAGAGGGAAGAAACAGATATTCTCGAGAATATCTGTTTCTTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-549s21c1
Sequence:CCGGGCACCAGAGCTCAATGAGAAACTCGAGTTTCTCATTGAGCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-143s21c1
Sequence:CCGGGAACAAAGAAACTCTCAAGTTCTCGAGAACTTGAGAGTTTCTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025486
VALIDATED
TMEM208 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 208
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025486.1-555s1c1
Sequence:CCGGGAGCTCAATGAGAAACGACAACTCGAGTTGTCGTTTCTCATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-211s1c1
Sequence:CCGGCCTTGGTCTTCTTCTATTCCTCTCGAGAGGAATAGAAGAAGACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025486.1-116s1c1
Sequence:CCGGCAGAGGGAAGAAACAGATATTCTCGAGAATATCTGTTTCTTCCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-143s1c1
Sequence:CCGGGAACAAAGAAACTCTCAAGTTCTCGAGAACTTGAGAGTTTCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-549s1c1
Sequence:CCGGGCACCAGAGCTCAATGAGAAACTCGAGTTTCTCATTGAGCTCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025486.1-407s1c1
Sequence:CCGGCCTACTGACAGCCATTGTTCACTCGAGTGAACAATGGCTGTCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-211s21c1
Sequence:CCGGCCTTGGTCTTCTTCTATTCCTCTCGAGAGGAATAGAAGAAGACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-116s21c1
Sequence:CCGGCAGAGGGAAGAAACAGATATTCTCGAGAATATCTGTTTCTTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-549s21c1
Sequence:CCGGGCACCAGAGCTCAATGAGAAACTCGAGTTTCTCATTGAGCTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025486.1-143s21c1
Sequence:CCGGGAACAAAGAAACTCTCAAGTTCTCGAGAACTTGAGAGTTTCTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks