EMAIL THIS PAGE TO A FRIEND

TMEM209

transmembrane protein 209

Synonyms: NET31
UniProtKB ID: Q96SK2, A4D1L1, Q49A50, Q6PF00, Q8NCH3, Q96SL6
Gene ID:
Mouse(72649) transmembrane protein 209
Rat(312200) transmembrane protein 209
Zebrafish(555279) transmembrane protein 209
chicken(416681) transmembrane protein 209
dog(475194) transmembrane protein 209
cow(510567) transmembrane protein 209
sheep(101115958) transmembrane protein 209
domestic guinea pig(100734743) transmembrane protein 209
naked mole-rat(101700816) transmembrane protein 209
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103315 Anti-FLJ14803, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, bovine, rat, horse, rabbit, canine, human
western blot pricing
HPA031678 Anti-TMEM209 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032842 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032842 Rosetta Predictions human pricing
NM_001014055 Rosetta Predictions rat pricing
NM_178625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164544 predicted 872
2 SASI_Hs01_00164546 predicted 1261
3 SASI_Hs02_00360437 predicted 1792
4 SASI_Hs01_00164547 predicted 1770
5 SASI_Hs01_00164548 predicted 1739
6 SASI_Hs01_00164550 predicted 1597
7 SASI_Hs02_00360438 predicted 1341
8 SASI_Hs01_00164551 predicted 1298
9 SASI_Hs01_00164552 predicted 1231
10 SASI_Hs01_00164553 predicted 833
11 SASI_Hs01_00164545 predicted 1065
12 SASI_Hs01_00164549 predicted 1821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115600 predicted 1235
2 SASI_Rn01_00115601 predicted 722
3 SASI_Rn01_00115602 predicted 1521
4 SASI_Rn01_00115603 predicted 809
5 SASI_Rn01_00115604 predicted 874
6 SASI_Rn01_00115605 predicted 1507
7 SASI_Rn01_00115606 predicted 892
8 SASI_Rn01_00115607 predicted 1148
9 SASI_Rn02_00201448 predicted 1102
10 SASI_Rn01_00115609 predicted 1029
11 SASI_Rn01_00115608 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348987 predicted 417
2 SASI_Mm01_00058474 predicted 1636
3 SASI_Mm02_00348988 predicted 710
4 SASI_Mm01_00058475 predicted 1139
5 SASI_Mm01_00058476 predicted 1353
6 SASI_Mm01_00058477 predicted 884
7 SASI_Mm01_00058479 predicted 1513
8 SASI_Mm01_00058480 predicted 366
9 SASI_Mm01_00058481 predicted 1231
10 SASI_Mm01_00058483 predicted 234
11 SASI_Mm01_00058478 predicted 875
12 SASI_Mm01_00058482 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178625
VALIDATED
TMEM209 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 209
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-132s21c1
Sequence:CCGGCCATGGCTGGAATGATATATACTCGAGTATATATCATTCCAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-938s21c1
Sequence:CCGGGCCGATCTCATTTCTAAGCAACTCGAGTTGCTTAGAAATGAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-1781s21c1
Sequence:CCGGTGCGCACCTCTTCTGACATAACTCGAGTTATGTCAGAAGAGGTGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-1550s21c1
Sequence:CCGGCAGCGGCATGTCTACAATCTTCTCGAGAAGATTGTAGACATGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178625.3-137s1c1
Sequence:CCGGGCTGGAATGATATATACTGAACTCGAGTTCAGTATATATCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178625.3-938s1c1
Sequence:CCGGGCCGATCTCATTTCTAAGCAACTCGAGTTGCTTAGAAATGAGATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178625.3-132s1c1
Sequence:CCGGCCATGGCTGGAATGATATATACTCGAGTATATATCATTCCAGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178625.3-1550s1c1
Sequence:CCGGCAGCGGCATGTCTACAATCTTCTCGAGAAGATTGTAGACATGCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178625
VALIDATED
TMEM209 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 209
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-132s21c1
Sequence:CCGGCCATGGCTGGAATGATATATACTCGAGTATATATCATTCCAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-938s21c1
Sequence:CCGGGCCGATCTCATTTCTAAGCAACTCGAGTTGCTTAGAAATGAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-1781s21c1
Sequence:CCGGTGCGCACCTCTTCTGACATAACTCGAGTTATGTCAGAAGAGGTGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-1550s21c1
Sequence:CCGGCAGCGGCATGTCTACAATCTTCTCGAGAAGATTGTAGACATGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178625.3-137s1c1
Sequence:CCGGGCTGGAATGATATATACTGAACTCGAGTTCAGTATATATCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178625.3-938s1c1
Sequence:CCGGGCCGATCTCATTTCTAAGCAACTCGAGTTGCTTAGAAATGAGATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178625.3-132s1c1
Sequence:CCGGCCATGGCTGGAATGATATATACTCGAGTATATATCATTCCAGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178625.3-1550s1c1
Sequence:CCGGCAGCGGCATGTCTACAATCTTCTCGAGAAGATTGTAGACATGCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178625
VALIDATED
TMEM209 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 209
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-132s21c1
Sequence:CCGGCCATGGCTGGAATGATATATACTCGAGTATATATCATTCCAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-938s21c1
Sequence:CCGGGCCGATCTCATTTCTAAGCAACTCGAGTTGCTTAGAAATGAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-1781s21c1
Sequence:CCGGTGCGCACCTCTTCTGACATAACTCGAGTTATGTCAGAAGAGGTGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178625.3-1550s21c1
Sequence:CCGGCAGCGGCATGTCTACAATCTTCTCGAGAAGATTGTAGACATGCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178625.3-137s1c1
Sequence:CCGGGCTGGAATGATATATACTGAACTCGAGTTCAGTATATATCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178625.3-938s1c1
Sequence:CCGGGCCGATCTCATTTCTAAGCAACTCGAGTTGCTTAGAAATGAGATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178625.3-132s1c1
Sequence:CCGGCCATGGCTGGAATGATATATACTCGAGTATATATCATTCCAGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178625.3-1550s1c1
Sequence:CCGGCAGCGGCATGTCTACAATCTTCTCGAGAAGATTGTAGACATGCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032842
VALIDATED
TMEM209 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 209
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032842.3-3010s21c1
Sequence:CCGGGCTTCCATCATCTTATGTAAACTCGAGTTTACATAAGATGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-1579s21c1
Sequence:CCGGCCAGATGTTACAAATGAGAATCTCGAGATTCTCATTTGTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-837s21c1
Sequence:CCGGCCTACGAACTTTGGATACTTTCTCGAGAAAGTATCCAAAGTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-1297s21c1
Sequence:CCGGCCGACTTTGAACACAATCGTTCTCGAGAACGATTGTGTTCAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-334s21c1
Sequence:CCGGGCATCTCTCTTCAGCCTTAATCTCGAGATTAAGGCTGAAGAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032842.2-2820s1c1
Sequence:CCGGGCTTCCATCATCTTATGTAAACTCGAGTTTACATAAGATGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032842.2-782s1c1
Sequence:CCGGCCTACGAACTTTGGATACTTTCTCGAGAAAGTATCCAAAGTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032842.2-1242s1c1
Sequence:CCGGCCGACTTTGAACACAATCGTTCTCGAGAACGATTGTGTTCAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032842.2-1524s1c1
Sequence:CCGGCCAGATGTTACAAATGAGAATCTCGAGATTCTCATTTGTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032842.2-279s1c1
Sequence:CCGGGCATCTCTCTTCAGCCTTAATCTCGAGATTAAGGCTGAAGAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032842
VALIDATED
TMEM209 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 209
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032842.3-3010s21c1
Sequence:CCGGGCTTCCATCATCTTATGTAAACTCGAGTTTACATAAGATGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-1579s21c1
Sequence:CCGGCCAGATGTTACAAATGAGAATCTCGAGATTCTCATTTGTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-837s21c1
Sequence:CCGGCCTACGAACTTTGGATACTTTCTCGAGAAAGTATCCAAAGTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-1297s21c1
Sequence:CCGGCCGACTTTGAACACAATCGTTCTCGAGAACGATTGTGTTCAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-334s21c1
Sequence:CCGGGCATCTCTCTTCAGCCTTAATCTCGAGATTAAGGCTGAAGAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032842.2-2820s1c1
Sequence:CCGGGCTTCCATCATCTTATGTAAACTCGAGTTTACATAAGATGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032842.2-782s1c1
Sequence:CCGGCCTACGAACTTTGGATACTTTCTCGAGAAAGTATCCAAAGTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032842.2-1242s1c1
Sequence:CCGGCCGACTTTGAACACAATCGTTCTCGAGAACGATTGTGTTCAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032842.2-1524s1c1
Sequence:CCGGCCAGATGTTACAAATGAGAATCTCGAGATTCTCATTTGTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032842.2-279s1c1
Sequence:CCGGGCATCTCTCTTCAGCCTTAATCTCGAGATTAAGGCTGAAGAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032842
VALIDATED
TMEM209 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 209
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032842.3-3010s21c1
Sequence:CCGGGCTTCCATCATCTTATGTAAACTCGAGTTTACATAAGATGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-1579s21c1
Sequence:CCGGCCAGATGTTACAAATGAGAATCTCGAGATTCTCATTTGTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-837s21c1
Sequence:CCGGCCTACGAACTTTGGATACTTTCTCGAGAAAGTATCCAAAGTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-1297s21c1
Sequence:CCGGCCGACTTTGAACACAATCGTTCTCGAGAACGATTGTGTTCAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032842.3-334s21c1
Sequence:CCGGGCATCTCTCTTCAGCCTTAATCTCGAGATTAAGGCTGAAGAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032842.2-2820s1c1
Sequence:CCGGGCTTCCATCATCTTATGTAAACTCGAGTTTACATAAGATGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032842.2-782s1c1
Sequence:CCGGCCTACGAACTTTGGATACTTTCTCGAGAAAGTATCCAAAGTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032842.2-1242s1c1
Sequence:CCGGCCGACTTTGAACACAATCGTTCTCGAGAACGATTGTGTTCAAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032842.2-1524s1c1
Sequence:CCGGCCAGATGTTACAAATGAGAATCTCGAGATTCTCATTTGTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032842.2-279s1c1
Sequence:CCGGGCATCTCTCTTCAGCCTTAATCTCGAGATTAAGGCTGAAGAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks