EMAIL THIS PAGE TO A FRIEND

TMEM211

transmembrane protein 211

Synonyms: bA9F11.1
UniProtKB ID: Q6ICI0
Gene ID:
Mouse(333048) transmembrane protein 211
Rat(679783) transmembrane protein 211
dog(477529) transmembrane protein 211
cow(540200) transmembrane protein 211
sheep(101116865) transmembrane protein 211
domestic guinea pig(100729955) transmembrane protein 211
naked mole-rat(101700513) transmembrane protein 211
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001663 Rosetta Predictions human pricing
XM_001054448 Rosetta Predictions rat pricing
NM_001033428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119658 predicted 215
2 SASI_Hs01_00119659 predicted 216
3 SASI_Hs01_00119660 predicted 221
4 SASI_Hs01_00119661 predicted 224
5 SASI_Hs01_00119662 predicted 221
6 SASI_Hs01_00119663 predicted 223
7 SASI_Hs01_00119664 predicted 212
8 SASI_Hs01_00119665 predicted 238
9 SASI_Hs01_00119666 predicted 216
10 SASI_Hs01_00119667 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275825 predicted 432
2 SASI_Rn02_00275826 predicted 425
3 SASI_Rn02_00275827 predicted 282
4 SASI_Rn02_00275828 predicted 300
5 SASI_Rn02_00275829 predicted 337
6 SASI_Rn02_00275830 predicted 328
7 SASI_Rn02_00275831 predicted 216
8 SASI_Rn02_00275832 predicted 365
9 SASI_Rn02_00275833 predicted 304
10 SASI_Rn02_00275834 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102044 predicted 821
2 SASI_Mm01_00102045 predicted 1042
3 SASI_Mm01_00102046 predicted 401
4 SASI_Mm02_00288739 predicted 816
5 SASI_Mm01_00102047 predicted 279
6 SASI_Mm01_00102049 predicted 971
7 SASI_Mm01_00102050 predicted 1198
8 SASI_Mm01_00102051 predicted 911
9 SASI_Mm01_00102052 predicted 903
10 SASI_Mm01_00102053 predicted 1027
11 SASI_Mm01_00102048 predicted 1301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001663
TMEM211 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 211
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-231s1c1
Sequence:CCGGCCTCCATGTATTATGGTGGGACTCGAGTCCCACCATAATACATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-227s1c1
Sequence:CCGGGCCTCCTCCATGTATTATGGTCTCGAGACCATAATACATGGAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-223s1c1
Sequence:CCGGCGAAGCCTCCTCCATGTATTACTCGAGTAATACATGGAGGAGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-224s1c1
Sequence:CCGGGAAGCCTCCTCCATGTATTATCTCGAGATAATACATGGAGGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-228s1c1
Sequence:CCGGCCTCCTCCATGTATTATGGTGCTCGAGCACCATAATACATGGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-202s1c1
Sequence:CCGGCCCATTCATCAAGGAAGTGTGCTCGAGCACACTTCCTTGATGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001663.1-149s21c1
Sequence:CCGGGCAGCTACTGCCATGATTGTGCTCGAGCACAATCATGGCAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001663.1-282s21c1
Sequence:CCGGCTATCCTCAATGCAGTCCTGGCTCGAGCCAGGACTGCATTGAGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001663.1-344s21c1
Sequence:CCGGGTCCAAGGGAGGACCATCATCCTCGAGGATGATGGTCCTCCCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001663
TMEM211 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 211
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-231s1c1
Sequence:CCGGCCTCCATGTATTATGGTGGGACTCGAGTCCCACCATAATACATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-227s1c1
Sequence:CCGGGCCTCCTCCATGTATTATGGTCTCGAGACCATAATACATGGAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-223s1c1
Sequence:CCGGCGAAGCCTCCTCCATGTATTACTCGAGTAATACATGGAGGAGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-224s1c1
Sequence:CCGGGAAGCCTCCTCCATGTATTATCTCGAGATAATACATGGAGGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-228s1c1
Sequence:CCGGCCTCCTCCATGTATTATGGTGCTCGAGCACCATAATACATGGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-202s1c1
Sequence:CCGGCCCATTCATCAAGGAAGTGTGCTCGAGCACACTTCCTTGATGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001663.1-149s21c1
Sequence:CCGGGCAGCTACTGCCATGATTGTGCTCGAGCACAATCATGGCAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001663.1-282s21c1
Sequence:CCGGCTATCCTCAATGCAGTCCTGGCTCGAGCCAGGACTGCATTGAGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001663.1-344s21c1
Sequence:CCGGGTCCAAGGGAGGACCATCATCCTCGAGGATGATGGTCCTCCCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001663
TMEM211 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 211
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-231s1c1
Sequence:CCGGCCTCCATGTATTATGGTGGGACTCGAGTCCCACCATAATACATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-227s1c1
Sequence:CCGGGCCTCCTCCATGTATTATGGTCTCGAGACCATAATACATGGAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-223s1c1
Sequence:CCGGCGAAGCCTCCTCCATGTATTACTCGAGTAATACATGGAGGAGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-224s1c1
Sequence:CCGGGAAGCCTCCTCCATGTATTATCTCGAGATAATACATGGAGGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-228s1c1
Sequence:CCGGCCTCCTCCATGTATTATGGTGCTCGAGCACCATAATACATGGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001663.1-202s1c1
Sequence:CCGGCCCATTCATCAAGGAAGTGTGCTCGAGCACACTTCCTTGATGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001663.1-149s21c1
Sequence:CCGGGCAGCTACTGCCATGATTGTGCTCGAGCACAATCATGGCAGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001663.1-282s21c1
Sequence:CCGGCTATCCTCAATGCAGTCCTGGCTCGAGCCAGGACTGCATTGAGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001663.1-344s21c1
Sequence:CCGGGTCCAAGGGAGGACCATCATCCTCGAGGATGATGGTCCTCCCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033428
TMEM211 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 211
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-820s21c1
Sequence:CCGGGCCATCCTTGTGCCAGAATAACTCGAGTTATTCTGGCACAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-711s21c1
Sequence:CCGGCTATGCCACTGCTATCCTCAACTCGAGTTGAGGATAGCAGTGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-344s21c1
Sequence:CCGGCCTCCTCTTATGGTATCTTTACTCGAGTAAAGATACCATAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-489s21c1
Sequence:CCGGGCTGTCAATCAGCGCTCTTCTCTCGAGAGAAGAGCGCTGATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033428.2-1008s21c1
Sequence:CCGGGTTGGCATAATGCCTACTTTGCTCGAGCAAAGTAGGCATTATGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033428
TMEM211 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 211
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-820s21c1
Sequence:CCGGGCCATCCTTGTGCCAGAATAACTCGAGTTATTCTGGCACAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-711s21c1
Sequence:CCGGCTATGCCACTGCTATCCTCAACTCGAGTTGAGGATAGCAGTGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-344s21c1
Sequence:CCGGCCTCCTCTTATGGTATCTTTACTCGAGTAAAGATACCATAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-489s21c1
Sequence:CCGGGCTGTCAATCAGCGCTCTTCTCTCGAGAGAAGAGCGCTGATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033428.2-1008s21c1
Sequence:CCGGGTTGGCATAATGCCTACTTTGCTCGAGCAAAGTAGGCATTATGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033428
TMEM211 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 211
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-820s21c1
Sequence:CCGGGCCATCCTTGTGCCAGAATAACTCGAGTTATTCTGGCACAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-711s21c1
Sequence:CCGGCTATGCCACTGCTATCCTCAACTCGAGTTGAGGATAGCAGTGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-344s21c1
Sequence:CCGGCCTCCTCTTATGGTATCTTTACTCGAGTAAAGATACCATAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033428.2-489s21c1
Sequence:CCGGGCTGTCAATCAGCGCTCTTCTCTCGAGAGAAGAGCGCTGATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033428.2-1008s21c1
Sequence:CCGGGTTGGCATAATGCCTACTTTGCTCGAGCAAAGTAGGCATTATGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks