EMAIL THIS PAGE TO A FRIEND

TMEM213

transmembrane protein 213

UniProtKB ID: A2RRL7, A4D1R3, C9JH49, C9JX41, C9K0P0
Gene ID:
Mouse(77522) transmembrane protein 213
Rat(689748) transmembrane protein 213
chicken(418103) transmembrane protein 213
domestic cat(101101206) transmembrane protein 213
dog(100684729) transmembrane protein 213
cow(510137) transmembrane protein 213
sheep(101104311) transmembrane protein 213
domestic guinea pig(100720810) transmembrane protein 213
naked mole-rat(101718693) transmembrane protein 213
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085429 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085429 Rosetta Predictions human pricing
XM_376677 Rosetta Predictions human pricing
XM_001071866 Rosetta Predictions rat pricing
XM_885435 Rosetta Predictions mouse pricing
XM_914650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317695 predicted 533
2 SASI_Hs02_00317696 predicted 571
3 SASI_Hs02_00317697 predicted 501
4 SASI_Hs02_00317698 predicted 458
5 SASI_Hs02_00317699 predicted 411
6 SASI_Hs02_00317700 predicted 604
7 SASI_Hs02_00317701 predicted 501
8 SASI_Hs02_00317702 predicted 452
9 SASI_Hs02_00317703 predicted 731
10 SASI_Hs02_00317704 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293777 predicted 580
2 SASI_Hs01_00293778 predicted 620
3 SASI_Hs01_00293779 predicted 647
4 SASI_Hs01_00293780 predicted 616
5 SASI_Hs01_00293781 predicted 541
6 SASI_Hs01_00293782 predicted 507
7 SASI_Hs01_00293783 predicted 455
8 SASI_Hs01_00293784 predicted 501
9 SASI_Hs01_00293785 predicted 539
10 SASI_Hs01_00293786 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336783 predicted 441
2 SASI_Rn02_00336784 predicted 448
3 SASI_Rn02_00336785 predicted 296
4 SASI_Rn02_00336786 predicted 160
5 SASI_Rn02_00336787 predicted 405
6 SASI_Rn02_00336788 predicted 442
7 SASI_Rn02_00336789 predicted 376
8 SASI_Rn02_00336790 predicted 272
9 SASI_Rn02_00336791 predicted 251
10 SASI_Rn02_00336792 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259950 predicted 351
2 SASI_Mm02_00428214 predicted 354
3 SASI_Mm01_00259951 predicted 353
4 SASI_Mm01_00259954 predicted 310
5 SASI_Mm01_00259955 predicted 362
6 SASI_Mm02_00428215 predicted 380
7 SASI_Mm02_00428216 predicted 363
8 SASI_Mm02_00428217 predicted 306
9 SASI_Mm02_00428218 predicted 391
10 SASI_Mm01_00259947 predicted 398
11 SASI_Mm01_00259946 predicted 409
12 SASI_Mm01_00259948 predicted 287
13 SASI_Mm01_00259949 predicted 410
14 SASI_Mm01_00259952 predicted 287
15 SASI_Mm01_00259953 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438763 predicted 394
2 SASI_Mm02_00438764 predicted 393
3 SASI_Mm02_00438765 predicted 400
4 SASI_Mm02_00438766 predicted 284
5 SASI_Mm02_00438767 predicted 402
6 SASI_Mm02_00438768 predicted 356
7 SASI_Mm02_00438769 predicted 349
8 SASI_Mm02_00438770 predicted 274
9 SASI_Mm02_00438771 predicted 244
10 SASI_Mm02_00438772 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085429
TMEM213 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 213
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000247649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085429.1-410s21c1
Sequence:CCGGATGAGCCCAAGGACTTGCAAGCTCGAGCTTGCAAGTCCTTGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085429.1-2863s21c1
Sequence:CCGGCCACAATATGTGACGGTTTATCTCGAGATAAACCGTCACATATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085429.1-257s21c1
Sequence:CCGGAGTGCCTCAACGTGGACTTCTCTCGAGAGAAGTCCACGTTGAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085429.1-372s21c1
Sequence:CCGGCCTGCTCTGTGTGGACAAACTCTCGAGAGTTTGTCCACACAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085429
TMEM213 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 213
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000247649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085429.1-410s21c1
Sequence:CCGGATGAGCCCAAGGACTTGCAAGCTCGAGCTTGCAAGTCCTTGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085429.1-2863s21c1
Sequence:CCGGCCACAATATGTGACGGTTTATCTCGAGATAAACCGTCACATATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085429.1-257s21c1
Sequence:CCGGAGTGCCTCAACGTGGACTTCTCTCGAGAGAAGTCCACGTTGAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085429.1-372s21c1
Sequence:CCGGCCTGCTCTGTGTGGACAAACTCTCGAGAGTTTGTCCACACAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085429
TMEM213 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 213
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000247649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085429.1-410s21c1
Sequence:CCGGATGAGCCCAAGGACTTGCAAGCTCGAGCTTGCAAGTCCTTGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085429.1-2863s21c1
Sequence:CCGGCCACAATATGTGACGGTTTATCTCGAGATAAACCGTCACATATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085429.1-257s21c1
Sequence:CCGGAGTGCCTCAACGTGGACTTCTCTCGAGAGAAGTCCACGTTGAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085429.1-372s21c1
Sequence:CCGGCCTGCTCTGTGTGGACAAACTCTCGAGAGTTTGTCCACACAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks