EMAIL THIS PAGE TO A FRIEND

TMEM214

transmembrane protein 214

Gene ID:
Mouse(68796) transmembrane protein 214
Rat(362711) transmembrane protein 214
naked mole-rat(101702818) transmembrane protein 214
Domestic Rabbit(100353086) transmembrane protein 214
domestic guinea pig(100715052) transmembrane protein 214
cow(514683) transmembrane protein 214
sheep(101111009) transmembrane protein 214
Zebrafish(402840) transmembrane protein 214
domestic cat(101091862) transmembrane protein 214
dog(610996) transmembrane protein 214
chicken(428658) transmembrane protein 214
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083590 Rosetta Predictions human pricing
NM_017727 Rosetta Predictions human pricing
NM_001014195 Rosetta Predictions rat pricing
NM_144525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316991 predicted 930
2 SASI_Hs02_00316992 predicted 896
3 SASI_Hs02_00316993 predicted 1262
4 SASI_Hs02_00316994 predicted 1687
5 SASI_Hs02_00316995 predicted 1017
6 SASI_Hs02_00316996 predicted 938
7 SASI_Hs02_00316997 predicted 2234
8 SASI_Hs02_00316998 predicted 2465
9 SASI_Hs02_00316999 predicted 2362
10 SASI_Hs02_00317000 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350497 predicted 1074
2 SASI_Hs01_00160116 predicted 1028
3 SASI_Hs01_00160117 predicted 1398
4 SASI_Hs01_00160118 predicted 1822
5 SASI_Hs02_00350498 predicted 1149
6 SASI_Hs02_00350499 predicted 1082
7 SASI_Hs02_00350500 predicted 2374
8 SASI_Hs02_00350501 predicted 2601
9 SASI_Hs02_00350502 predicted 2499
10 SASI_Hs02_00350503 predicted 1409
11 SASI_Hs01_00160112 predicted 749
12 SASI_Hs01_00160113 predicted 1141
13 SASI_Hs01_00160114 predicted 2192
14 SASI_Hs01_00160115 predicted 1030
15 SASI_Hs01_00160119 predicted 663
16 SASI_Hs01_00160120 predicted 466
17 SASI_Hs01_00160121 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059374 predicted 1085
2 SASI_Rn01_00059377 predicted 1337
3 SASI_Rn02_00201712 predicted 1760
4 SASI_Rn01_00059378 predicted 1984
5 SASI_Rn02_00201713 predicted 213
6 SASI_Rn01_00059379 predicted 794
7 SASI_Rn01_00059380 predicted 799
8 SASI_Rn01_00059382 predicted 1354
9 SASI_Rn01_00059383 predicted 1010
10 SASI_Rn02_00201714 predicted 696
11 SASI_Rn01_00059375 predicted 1523
12 SASI_Rn01_00059376 predicted 957
13 SASI_Rn01_00059381 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190289 predicted 1057
2 SASI_Mm01_00190290 predicted 1512
3 SASI_Mm01_00190291 predicted 777
4 SASI_Mm01_00190293 predicted 268
5 SASI_Mm02_00340045 predicted 1576
6 SASI_Mm01_00190294 predicted 992
7 SASI_Mm01_00190295 predicted 680
8 SASI_Mm01_00190296 predicted 1110
9 SASI_Mm01_00190297 predicted 1723
10 SASI_Mm01_00190298 predicted 1711
11 SASI_Mm01_00190292 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017727
VALIDATED
TMEM214 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 214
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017727.4-1400s21c1
Sequence:CCGGGAAGGTACAGAAGTCTTTGCACTCGAGTGCAAAGACTTCTGTACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017727.4-2115s21c1
Sequence:CCGGCTTTGCCTACAGGACATTACACTCGAGTGTAATGTCCTGTAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017727.4-2248s21c1
Sequence:CCGGGCAGTTCTTCATGGGAGTCTTCTCGAGAAGACTCCCATGAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017727.4-1418s21c1
Sequence:CCGGGCAAGAAACCATTCAGTCCCTCTCGAGAGGGACTGAATGGTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.2-1251s1c1
Sequence:CCGGGAAGGTACAGAAGTCTTTGCACTCGAGTGCAAAGACTTCTGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.3-2201s1c1
Sequence:CCGGCAGTTCTTCATGGGAGTCTTTCTCGAGAAAGACTCCCATGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.3-2200s1c1
Sequence:CCGGGCAGTTCTTCATGGGAGTCTTCTCGAGAAGACTCCCATGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017727.2-1506s1c1
Sequence:CCGGGCTTCGATCATCTGGCTTCTTCTCGAGAAGAAGCCAGATGATCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-925s1c1
Sequence:CCGGCCACTTCTGGACTTTGCCTATCTCGAGATAGGCAAAGTCCAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017727.2-1095s1c1
Sequence:CCGGCCCTGAGATGAAGAAAGAGCTCTCGAGAGCTCTTTCTTCATCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.2-1926s1c1
Sequence:CCGGCATGAAGACACAGCTCAGTGACTCGAGTCACTGAGCTGTGTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.2-1770s1c1
Sequence:CCGGCGATTCCGTGAATCAGCTACTCTCGAGAGTAGCTGATTCACGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-1269s1c1
Sequence:CCGGGCAAGAAACCATTCAGTCCCTCTCGAGAGGGACTGAATGGTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-831s1c1
Sequence:CCGGGTCTCCCTTTGCCATCACATACTCGAGTATGTGATGGCAAAGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-1966s1c1
Sequence:CCGGCTTTGCCTACAGGACATTACACTCGAGTGTAATGTCCTGTAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017727
VALIDATED
TMEM214 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 214
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017727.4-1400s21c1
Sequence:CCGGGAAGGTACAGAAGTCTTTGCACTCGAGTGCAAAGACTTCTGTACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017727.4-2115s21c1
Sequence:CCGGCTTTGCCTACAGGACATTACACTCGAGTGTAATGTCCTGTAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017727.4-2248s21c1
Sequence:CCGGGCAGTTCTTCATGGGAGTCTTCTCGAGAAGACTCCCATGAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017727.4-1418s21c1
Sequence:CCGGGCAAGAAACCATTCAGTCCCTCTCGAGAGGGACTGAATGGTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.2-1251s1c1
Sequence:CCGGGAAGGTACAGAAGTCTTTGCACTCGAGTGCAAAGACTTCTGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.3-2201s1c1
Sequence:CCGGCAGTTCTTCATGGGAGTCTTTCTCGAGAAAGACTCCCATGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.3-2200s1c1
Sequence:CCGGGCAGTTCTTCATGGGAGTCTTCTCGAGAAGACTCCCATGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017727.2-1506s1c1
Sequence:CCGGGCTTCGATCATCTGGCTTCTTCTCGAGAAGAAGCCAGATGATCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-925s1c1
Sequence:CCGGCCACTTCTGGACTTTGCCTATCTCGAGATAGGCAAAGTCCAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017727.2-1095s1c1
Sequence:CCGGCCCTGAGATGAAGAAAGAGCTCTCGAGAGCTCTTTCTTCATCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.2-1926s1c1
Sequence:CCGGCATGAAGACACAGCTCAGTGACTCGAGTCACTGAGCTGTGTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.2-1770s1c1
Sequence:CCGGCGATTCCGTGAATCAGCTACTCTCGAGAGTAGCTGATTCACGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-1269s1c1
Sequence:CCGGGCAAGAAACCATTCAGTCCCTCTCGAGAGGGACTGAATGGTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-831s1c1
Sequence:CCGGGTCTCCCTTTGCCATCACATACTCGAGTATGTGATGGCAAAGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-1966s1c1
Sequence:CCGGCTTTGCCTACAGGACATTACACTCGAGTGTAATGTCCTGTAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017727
VALIDATED
TMEM214 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 214
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017727.4-1400s21c1
Sequence:CCGGGAAGGTACAGAAGTCTTTGCACTCGAGTGCAAAGACTTCTGTACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017727.4-2115s21c1
Sequence:CCGGCTTTGCCTACAGGACATTACACTCGAGTGTAATGTCCTGTAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017727.4-2248s21c1
Sequence:CCGGGCAGTTCTTCATGGGAGTCTTCTCGAGAAGACTCCCATGAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017727.4-1418s21c1
Sequence:CCGGGCAAGAAACCATTCAGTCCCTCTCGAGAGGGACTGAATGGTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.2-1251s1c1
Sequence:CCGGGAAGGTACAGAAGTCTTTGCACTCGAGTGCAAAGACTTCTGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.3-2201s1c1
Sequence:CCGGCAGTTCTTCATGGGAGTCTTTCTCGAGAAAGACTCCCATGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.3-2200s1c1
Sequence:CCGGGCAGTTCTTCATGGGAGTCTTCTCGAGAAGACTCCCATGAAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017727.2-1506s1c1
Sequence:CCGGGCTTCGATCATCTGGCTTCTTCTCGAGAAGAAGCCAGATGATCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-925s1c1
Sequence:CCGGCCACTTCTGGACTTTGCCTATCTCGAGATAGGCAAAGTCCAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017727.2-1095s1c1
Sequence:CCGGCCCTGAGATGAAGAAAGAGCTCTCGAGAGCTCTTTCTTCATCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.2-1926s1c1
Sequence:CCGGCATGAAGACACAGCTCAGTGACTCGAGTCACTGAGCTGTGTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017727.2-1770s1c1
Sequence:CCGGCGATTCCGTGAATCAGCTACTCTCGAGAGTAGCTGATTCACGGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-1269s1c1
Sequence:CCGGGCAAGAAACCATTCAGTCCCTCTCGAGAGGGACTGAATGGTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-831s1c1
Sequence:CCGGGTCTCCCTTTGCCATCACATACTCGAGTATGTGATGGCAAAGGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017727.2-1966s1c1
Sequence:CCGGCTTTGCCTACAGGACATTACACTCGAGTGTAATGTCCTGTAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144525
VALIDATED
TMEM214 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein 214
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144525.3-1316s21c1
Sequence:CCGGCACGGAAATCTTTACAAGAAACTCGAGTTTCTTGTAAAGATTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144525.3-2607s21c1
Sequence:CCGGCCTTGGCTTCTCAACTCCATTCTCGAGAATGGAGTTGAGAAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144525.3-180s21c1
Sequence:CCGGCCAGACTACAAGCACTCTTTACTCGAGTAAAGAGTGCTTGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144525.3-262s21c1
Sequence:CCGGGCAGAGTCTAAGAAACCGATACTCGAGTATCGGTTTCTTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-2609s1c1
Sequence:CCGGCCTTGGCTTCTCAACTCCATTCTCGAGAATGGAGTTGAGAAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-1318s1c1
Sequence:CCGGCACGGAAATCTTTACAAGAAACTCGAGTTTCTTGTAAAGATTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-264s1c1
Sequence:CCGGGCAGAGTCTAAGAAACCGATACTCGAGTATCGGTTTCTTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-182s1c1
Sequence:CCGGCCAGACTACAAGCACTCTTTACTCGAGTAAAGAGTGCTTGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-1500s1c1
Sequence:CCGGGCAGTAGGATTCCTATGTCATCTCGAGATGACATAGGAATCCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144525
VALIDATED
TMEM214 MISSION shRNA shRNA Plasmid DNA
transmembrane protein 214
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144525.3-1316s21c1
Sequence:CCGGCACGGAAATCTTTACAAGAAACTCGAGTTTCTTGTAAAGATTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144525.3-2607s21c1
Sequence:CCGGCCTTGGCTTCTCAACTCCATTCTCGAGAATGGAGTTGAGAAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144525.3-180s21c1
Sequence:CCGGCCAGACTACAAGCACTCTTTACTCGAGTAAAGAGTGCTTGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144525.3-262s21c1
Sequence:CCGGGCAGAGTCTAAGAAACCGATACTCGAGTATCGGTTTCTTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-2609s1c1
Sequence:CCGGCCTTGGCTTCTCAACTCCATTCTCGAGAATGGAGTTGAGAAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-1318s1c1
Sequence:CCGGCACGGAAATCTTTACAAGAAACTCGAGTTTCTTGTAAAGATTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-264s1c1
Sequence:CCGGGCAGAGTCTAAGAAACCGATACTCGAGTATCGGTTTCTTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-182s1c1
Sequence:CCGGCCAGACTACAAGCACTCTTTACTCGAGTAAAGAGTGCTTGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-1500s1c1
Sequence:CCGGGCAGTAGGATTCCTATGTCATCTCGAGATGACATAGGAATCCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144525
VALIDATED
TMEM214 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein 214
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144525.3-1316s21c1
Sequence:CCGGCACGGAAATCTTTACAAGAAACTCGAGTTTCTTGTAAAGATTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144525.3-2607s21c1
Sequence:CCGGCCTTGGCTTCTCAACTCCATTCTCGAGAATGGAGTTGAGAAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144525.3-180s21c1
Sequence:CCGGCCAGACTACAAGCACTCTTTACTCGAGTAAAGAGTGCTTGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144525.3-262s21c1
Sequence:CCGGGCAGAGTCTAAGAAACCGATACTCGAGTATCGGTTTCTTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-2609s1c1
Sequence:CCGGCCTTGGCTTCTCAACTCCATTCTCGAGAATGGAGTTGAGAAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-1318s1c1
Sequence:CCGGCACGGAAATCTTTACAAGAAACTCGAGTTTCTTGTAAAGATTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-264s1c1
Sequence:CCGGGCAGAGTCTAAGAAACCGATACTCGAGTATCGGTTTCTTAGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-182s1c1
Sequence:CCGGCCAGACTACAAGCACTCTTTACTCGAGTAAAGAGTGCTTGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144525.2-1500s1c1
Sequence:CCGGGCAGTAGGATTCCTATGTCATCTCGAGATGACATAGGAATCCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks